NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL19441 Query DataSets for GPL19441
Status Public on Nov 01, 2015
Title Illumina mouseref-8_v2_0_r3 expression beadchip
Technology type oligonucleotide beads
Distribution custom-commercial
Organism Mus musculus
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
 
Submission date Nov 19, 2014
Last update date Nov 01, 2015
Contact name Yibayiri Osee Sanogo
Organization name Cleveland Clinic Foundation
Department Genomics Core
Street address 9500 S Euclid Ave
City Cleveland
State/province OH
ZIP/Postal code 44195
Country USA
 
Samples (34) GSM1550129, GSM1550130, GSM1550131, GSM1550132, GSM1550133, GSM1550134 
Series (6)
GSE63455 IL-27 stimulation in Foxp3+ Tregs improves suppressive function and therapeutic efficacy
GSE74696 G0S2 functions as a tumor supressor through represssion of Myc signaling pathways
GSE77419 PDGF Engages an E2F-USP1 Signaling Pathway to Support ID2-mediated Survival of Proneural Glioma Cells.

Data table header descriptions
ID
SPECIES
SOURCE Transcript sequence source name
SEARCH_KEY Internal id useful for custom design array
TRANSCRIPT Internal transcript id
ILMN_GENE Internal gene symbol
SOURCE_REFERENCE_ID Id in the source database
REFSEQ_ID Refseq id
ENTREZ_GENE_ID Entrez gene id
GI Genbank id
GB_ACC GenBank Accession number
SYMBOL Gene symbol from the source database
PROTEIN_PRODUCT Genbank protein accession number
PROBE_ID
ARRAY_ADDRESS_ID Decoder id
PROBE_TYPE Information about what this probe is targeting
PROBE_START Position of the probe relative to the 5' of the source transcript sequence
PROBE_SEQUENCE
CHROMOSOME Chromosome
PROBE_CHR_ORIENTATION Orientation on the NCBI genome built
PROBE_COORDINATES genomic position of the probe on the NCBI genome built
CYTOBAND
DEFINITION Gene description from the source
ONTOLOGY_COMPONENT Cellular component annotations from Gene Ontology project
ONTOLOGY_PROCESS Biological process annotations from Gene Ontology project
ONTOLOGY_FUNCTION Molecular function annotations from Gene Ontology project
SYNONYMS Gene symbol synonyms from Refseq
OBSOLETE_PROBE_ID Identifier of probe id before bgx time

Data table
ID SPECIES SOURCE SEARCH_KEY TRANSCRIPT ILMN_GENE SOURCE_REFERENCE_ID REFSEQ_ID ENTREZ_GENE_ID GI GB_ACC SYMBOL PROTEIN_PRODUCT PROBE_ID ARRAY_ADDRESS_ID PROBE_TYPE PROBE_START PROBE_SEQUENCE CHROMOSOME PROBE_CHR_ORIENTATION PROBE_COORDINATES CYTOBAND DEFINITION ONTOLOGY_COMPONENT ONTOLOGY_PROCESS ONTOLOGY_FUNCTION SYNONYMS OBSOLETE_PROBE_ID
ILMN_2896528 Mus musculus RefSeq ILMN_220369 ILMN_220369 0610006I08RIK NM_025791.1 NM_025791.1 66836 13385261 NM_025791.1 0610006I08Rik NP_080067.1 ILMN_2896528 1940731 S 521 GGCCGGCGCTTCTACTTCCTTTTGGACAAAGCTGGACACTTTCCCAACAC 19 + 8846738-8846787 19qA "Mus musculus RIKEN cDNA 0610006I08 gene (0610006I08Rik), mRNA." "Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]"
ILMN_2721178 Mus musculus RefSeq ILMN_220369 ILMN_220369 0610006I08RIK NM_025791.1 NM_025791.1 66836 13385261 NM_025791.1 0610006I08Rik NP_080067.1 ILMN_2721178 3120133 S 190 GACCTCCCTGGCTGTTGCAGCCTTGTCCAGACCTCTGAGCCGAGTACCTG 19 + 8845675-8845724 19qA "Mus musculus RIKEN cDNA 0610006I08 gene (0610006I08Rik), mRNA." "Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]"
ILMN_3033922 Mus musculus RefSeq ILMN_244468 ILMN_244468 0610007C21RIK NM_027855.2 NM_027855.2 381629 47087145 NM_027855.2 0610007C21Rik NP_082131.2 ILMN_3033922 1690678 I 139 GCTTACTGTGAGGATACATCGAAGCTAATGCAGGCCCGATGCTGCCTGAA 5 + 31351883-31351932 5qB1 "Mus musculus RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 1, mRNA." "Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA]" AI316792; HSPC013; Apr3; p18 AI316792; HSPC013; Apr3; p18
ILMN_3092673 Mus musculus RefSeq ILMN_229637 ILMN_229637 0610007C21RIK NM_212470.2 NM_212470.2 381629 57526830 NM_212470.2 0610007C21Rik NP_997635.1 ILMN_3092673 2710446 A 743 ATTGCACCACCTCGGGGGTCTTGTGGACACTTGGTTCAGGAGTGGACTCG 5 + 31356894-31356943 5qB1 "Mus musculus RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 2, mRNA." "Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]; The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins [goid 5886] [evidence IEA]" AI316792; HSPC013; Apr3; p18 AI316792; HSPC013; Apr3; p18
ILMN_2816356 Mus musculus RefSeq ILMN_196322 ILMN_196322 0610007P08RIK NM_023507.3 NM_023507.3 76251 91807127 NM_023507.3 0610007P08Rik NP_075996.2 ILMN_2816356 4610239 S 2173 GGTGTCCACAACCTCTTCAAACTAAGGTCCCAAGGGTCATGTCTTACGAG 13 + 63970424-63970473 13qB3 "Mus musculus RIKEN cDNA 0610007P08 gene (0610007P08Rik), transcript variant 2, mRNA." "A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]" "The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway [goid 6281] [evidence IEA]; A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism [goid 6974] [evidence IEA]" "Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3 [goid 16787] [evidence IEA]; Catalysis of the reaction: NTP + H2O = NDP + phosphate to drive the unwinding of a DNA or RNA helix [goid 4386] [evidence IEA]; Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]; Interacting selectively with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator [goid 5524] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Catalysis of the reaction: ATP + H2O = ADP + phosphate to drive the unwinding of a DNA or RNA helix [goid 8026] [evidence IEA]" RAD26L; 1700019D06Rik RAD26L; 1700019D06Rik
ILMN_2808939 Mus musculus RefSeq ILMN_239772 ILMN_239772 0610007P14RIK NM_021446.1 NM_021446.1 58520 10946821 NM_021446.1 0610007P14Rik NP_067421.1 ILMN_2808939 1230730 S 963 GGGCACAGGGCTGCTTCAAGGTCCTGAGCACATAGACTGGGCTCCTTTCT 12 - 86704730-86704779 12qD2 "Mus musculus RIKEN cDNA 0610007P14 gene (0610007P14Rik), mRNA." "The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached) [goid 5783] [evidence IEA]; Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]" "The chemical reactions and pathways resulting in the formation of sterols, steroids with one or more hydroxyl groups and a hydrocarbon side-chain in the molecule [goid 16126] [evidence IEA]; The chemical reactions and pathways resulting in the formation of steroids, compounds with a 1,2,cyclopentanoperhydrophenanthrene nucleus; includes de novo formation and steroid interconversion by modification [goid 6694] [evidence IEA]; The chemical reactions and pathways resulting in the formation of lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent [goid 8610] [evidence IEA]" AU019315; C77855; 1190004E09Rik; ORF11 AU019315; C77855; 1190004E09Rik; ORF11
ILMN_2634564 Mus musculus RefSeq ILMN_213192 ILMN_213192 0610007P22RIK NM_026676.1 NM_026676.1 68327 21489946 NM_026676.1 0610007P22Rik NP_080952.1 ILMN_2634564 1070170 S 1050 CTGGTGTGCATTATTCAGAAGTGGCAGTAGGACCTGGGGATGGACGGGCC 17 + 24970285-24970334 17qA3.3 "Mus musculus RIKEN cDNA 0610007P22 gene (0610007P22Rik), mRNA." "Penetrating at least one phospholipid bilayer of a membrane. May also refer to the state of being buried in the bilayer with no exposure outside the bilayer. When used to describe a protein, indicates that all or part of the peptide sequence is embedded in the membrane [goid 16021] [evidence IEA]; Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]" AL022759; MGC113771; 1110014B11Rik AL022759; MGC113771; 1110014B11Rik
ILMN_2737647 Mus musculus RefSeq ILMN_221600 ILMN_221600 0610008C08RIK NM_026673.2 NM_026673.2 68316 142368551 NM_026673.2 0610008C08Rik NP_080949.1 ILMN_2737647 2630593 S 279 CGTGCCCACCTCCTCGGCTAATGCCCTTTTGGGGTTGTGGGGAGGATGAA X + 91612771-91612789:91612790-91612820 XqC3 "Mus musculus RIKEN cDNA 0610008C08 gene (0610008C08Rik), mRNA." RP23-272D10.2; MGC130105; MGC130106; 1110019O03Rik RP23-272D10.2; MGC130105; MGC130106; 1110019O03Rik
ILMN_2734484 Mus musculus RefSeq ILMN_221361 ILMN_221361 0610009B22RIK NM_025319.2 NM_025319.2 66050 141801968 NM_025319.2 0610009B22Rik NP_079595.1 ILMN_2734484 6280440 S 403 TCTTCACTGACGTCTACGACTTATACATCAAATTTGCCATGAATCCCTTT 11 - 51499229-51499278 11qB1.3 "Mus musculus RIKEN cDNA 0610009B22 gene (0610009B22Rik), mRNA." RP23-79E13.7 RP23-79E13.7
ILMN_2952292 Mus musculus RefSeq ILMN_218698 ILMN_218698 0610009D07RIK NM_025323.2 NM_025323.2 66055 31981274 NM_025323.2 0610009D07Rik NP_079599.1 ILMN_2952292 3060092 S 1065 CTTGCCTTGGTCATGATGTCTGCTCACAGCCTTAAAACCCTTAAAACACT 12 + 4834414-4834463 12qA1.1 "Mus musculus RIKEN cDNA 0610009D07 gene (0610009D07Rik), mRNA." "A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]" Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA] "Interacting selectively with an RNA molecule or a portion thereof [goid 3723] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]" 6030419K15Rik; AV001342; Sf3b14 6030419K15Rik; AV001342; Sf3b14
ILMN_2699078 Mus musculus RefSeq ILMN_218698 ILMN_218698 0610009D07RIK NM_025323.2 NM_025323.2 66055 31981274 NM_025323.2 0610009D07Rik NP_079599.1 ILMN_2699078 6290215 S 608 TTAATTAGTACTGAATATTGTGATTTCTTATTTGAGAACTAGAATGACTT 12 + 4833957-4834006 12qA1.1 "Mus musculus RIKEN cDNA 0610009D07 gene (0610009D07Rik), mRNA." "A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]" Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide [goid 6397] [evidence IEA]; The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA [goid 8380] [evidence IEA] "Interacting selectively with an RNA molecule or a portion thereof [goid 3723] [evidence IEA]; Interacting selectively with any nucleic acid [goid 3676] [evidence IEA]; Interacting selectively with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose moiety [goid 166] [evidence IEA]" 6030419K15Rik; AV001342; Sf3b14 6030419K15Rik; AV001342; Sf3b14
ILMN_1213681 Mus musculus RefSeq ILMN_220613 ILMN_220613 0610009O20RIK NM_024179.4 NM_024179.4 66839 142383028 NM_024179.4 0610009O20Rik NP_077141.2 ILMN_1213681 2900228 S 1911 CTCCTTGCTTAGGTTCCTGAAGACAGACTGGTGCCCACAGTTCCATGGCC 18 + 38421800-38421849 18qB3 "Mus musculus RIKEN cDNA 0610009O20 gene (0610009O20Rik), mRNA." "The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA]" 2700004E22Rik 2700004E22Rik
ILMN_2735413 Mus musculus RefSeq ILMN_221425 ILMN_221425 0610010D20RIK NM_026152.1 NM_026152.1 67432 13385655 NM_026152.1 0610010D20Rik NP_080428.1 ILMN_2735413 2850424 S 911 TGAAGAAAACCATGGACTGGTTTGGCTACTATGGAGGTCCCTGCCGCGCC 19 + 42144705-42144754 19qC3 "Mus musculus RIKEN cDNA 0610010D20 gene (0610010D20Rik), mRNA." "A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA]" "The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]" "Catalysis of the cleavage of C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation, or conversely adding a group to a double bond. They differ from other enzymes in that two substrates are involved in one reaction direction, but only one in the other direction. When acting on the single substrate, a molecule is eliminated and this generates either a new double bond or a new ring [goid 16829] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]"
ILMN_2735415 Mus musculus RefSeq ILMN_221425 ILMN_221425 0610010D20RIK NM_026152.1 NM_026152.1 67432 13385655 NM_026152.1 0610010D20Rik NP_080428.1 ILMN_2735415 3190008 S 914 AAGAAAACCATGGACTGGTTTGGCTACTATGGAGGTCCCTGCCGCGCCCC 19 + 42144708-42144757 19qC3 "Mus musculus RIKEN cDNA 0610010D20 gene (0610010D20Rik), mRNA." "A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration [goid 5739] [evidence IDA]" "The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]" "Catalysis of the cleavage of C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation, or conversely adding a group to a double bond. They differ from other enzymes in that two substrates are involved in one reaction direction, but only one in the other direction. When acting on the single substrate, a molecule is eliminated and this generates either a new double bond or a new ring [goid 16829] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]"
ILMN_2891688 Mus musculus RefSeq ILMN_244634 ILMN_244634 0610010E21RIK NM_001033140.3 NM_001033140.3 68332 111118962 NM_001033140.3 0610010E21Rik NP_001028312.2 ILMN_2891688 3390088 S 773 CCCTGATGAACCGTGAGAAACTTGGCAGTCTGACTCGTTGTGAAGAACCG 7 - 31106572-31106621 7qB1 "Mus musculus RIKEN cDNA 0610010E21 gene (0610010E21Rik), mRNA." AW490662; AI430885 AW490662; AI430885
ILMN_2637698 Mus musculus RefSeq ILMN_213500 ILMN_224439 0610010K06RIK NM_027861.2 NM_027861.2 71678 124244090 NM_027861.2 0610010K06Rik NP_082137.1 ILMN_2637698 1500400 S 3168 GGCCATGTTCACGTGATCGCATGAGCAGTCTTGTTGATTGTAAAGCTAAC 1|NT_165754.2 - 249928-249977 "Mus musculus RIKEN cDNA 0610010K06 gene (0610010K06Rik), mRNA." "Double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins [goid 16020] [evidence IEA]"
ILMN_2674228 Mus musculus RefSeq ILMN_216704 ILMN_216704 0610010K14RIK NM_026757.1 NM_026757.1 104457 21389317 NM_026757.1 0610010K14Rik NP_081033.1 ILMN_2674228 2690324 S 318 ATGACGTCCGGTGTCCTCTCACCTCCAAACGCCCCTCCACCCAGCAGCTC 11 - 70051096-70051106:70051033-70051071 11qB3 "Mus musculus RIKEN cDNA 0610010K14 gene (0610010K14Rik), mRNA." "A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent [goid 5634] [evidence IEA]" Interacting selectively with DNA (deoxyribonucleic acid) [goid 3677] [evidence IEA] AL033328; RP23-198E14.7; AU045833; 1110020A23Rik AL033328; RP23-198E14.7; AU045833; 1110020A23Rik
ILMN_2601546 Mus musculus RefSeq ILMN_210035 ILMN_210035 0610011L14RIK NM_026661.3 NM_026661.3 68295 142365065 NM_026661.3 0610011L14Rik NP_080937.2 ILMN_2601546 1710201 S 3229 CATTCACTAACAGACTGTGTTGGGGTTAGGAGGCCACACGACATGCAGGC 2 + 156394513-156394562 2qH1 "Mus musculus RIKEN cDNA 0610011L14 gene (0610011L14Rik), mRNA." Interacting selectively with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules) [goid 5515] [evidence IPI]
ILMN_1230831 Mus musculus MEEBO ILMN_189615 ILMN_189615 0610012A05RIK scl47331.6_185 21539602 NM_026153 0610012A05Rik ILMN_1230831 6900731 S 1 AAGGAAGTTATAGGTGAGAGGCTTGTGGAGAGGGGCTAACTCCAGTCCCC
ILMN_2848071 Mus musculus RefSeq ILMN_213393 ILMN_213393 0610012D14RIK NM_026690.1 NM_026690.1 68352 21312001 NM_026690.1 0610012D14Rik NP_080966.1 ILMN_2848071 360544 S 652 CCCCAGTCTAGGCTTCGACCGTGTCATTGGGGTGCTTGTGGCTGACCTTA 7 + 51722425-51722474 7qB4 "Mus musculus RIKEN cDNA 0610012D14 gene (0610012D14Rik), mRNA." "The process of removal or addition of one or more electrons with or without the concomitant removal or addition of a proton or protons [goid 55114] [evidence IEA]; The chemical reactions and pathways resulting in the formation of a pyridine nucleotide, a nucleotide characterized by a pyridine derivative as a nitrogen base [goid 19363] [evidence IEA]; The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation [goid 8152] [evidence IEA]; The chemical reactions and pathways resulting in the breakdown of nicotinamide-adenine dinucleotide phosphate, a coenzyme involved in many redox and biosynthetic reactions; catabolism may be of either the oxidized form, NADP, or the reduced form, NADPH [goid 6742] [evidence IEA]" "Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced [goid 16491] [evidence IEA]; Catalysis of the reaction: L-aspartate + H2O + NAD(P)+ = oxaloacetate + NH3 + NAD(P)H + H+ [goid 33735] [evidence IEA]; Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic [goid 3824] [evidence IEA]; The selective, often stoichiometric, interaction of a molecule with one or more specific sites on another molecule [goid 5488] [evidence IEA]"

Total number of rows: 25697

Table truncated, full table size 46286 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap