NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL23501 Query DataSets for GPL23501
Status Public on May 13, 2019
Title USC/ACUIGEN-Ruditapes philippinarum-8 × 15 k-designID: 072098
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Ruditapes philippinarum
Manufacturer Acuigen group, Dpto de Zoología, Genética y Antropología Física,Facultad Veterinaria, Campus de Lugo, Universidade de Santiago de Compostela
Manufacture protocol A total of 14,615 oligo-probes corresponding to 11,288 different Manila clam transcripts, 10,987 of them (97.9%) annotated. A total of 9,094 oligo-probes came from the HS-transcriptome, while 5,521 oligo-probes were from MR- and ML-transcriptomes. Among the HS-transcriptome probes, 5,770 corresponded to consistently annotated transcripts in the NCBI nr protein database and 236 DE to non-annotated transcripts, but showing a high DE between infected and control clams (Hasanuzzamann et al., 2017). This latter set consisted in 472 probes since forward and reverse oligo-probes were necessary. Finally, 2,852 transcripts annotated to well-known proteins were replicated. Regarding the other two reported transcriptomes, a total of 3,627 oligo-probes corresponded to the MR-transcriptome (584 of them associated with immune response), 1,605 to the ML-transcriptome, and 289 were common to both MR and ML transcriptomes.The probes were synthesized in a random layout using the Agilent methodology.
 
 
Submission date May 22, 2017
Last update date May 13, 2019
Contact name Belen G Pardo
E-mail(s) belen.gomez@usc.es
Phone +34 982822428
Organization name University of Santiago de Compostela
Department Zoology, Genetics and Physical Anthropology
Lab Acuigen
Street address Avda. Carballo Calero s/n
City LUGO
State/province LUGO
ZIP/Postal code 27002
Country Spain
 
Samples (48) GSM2634665, GSM2634666, GSM2634667, GSM2634668, GSM2634669, GSM2634670 
Series (3)
GSE99162 Gene Expression Analysis of Ruditapes philippinarum Haemocytes after Experimental Perkinsus olseni Zoospore Challenge and Infection in the Wild
GSE142172 Manila clam - Perkinsus olseni interaction based on gene expression analysis of clam hemocytes and parasite trophozoites [Manila clam]
GSE142666 New insights into the Manila clam – Perkinsus olseni interaction based on gene expression analysis of clam hemocytes and parasite trophozoites through in vitro challenges

Data table header descriptions
ID
Row Matrix Row
Col Matrix Column
ControlType Control Probe : 1; otherwise : 0
ProbeName Probe Name
SPOT_ID
SEQUENCE Probe Oligo
Ref_seq_Anot genebank number of annotating sequence
Annotation Sequence Annotation

Data table
ID Row Col ControlType ProbeName SPOT_ID SEQUENCE Ref_seq_Anot Annotation
1 1 1 1 GE_BrightCorner CONTROL
2 1 2 1 DarkCorner CONTROL
3 1 3 1 DarkCorner CONTROL
4 1 4 0 Contig7783reverse.0 CACTGCTGGTGTCTCAATTAAGCCGGCTTTGCTGCTGTTCATCTCTTCAGAGTTG gb|EKC18506.1| WD repeat-containing protein 55, partial [Crassostrea gigas]
5 1 5 0 comp369067_c0_seq1reverse.0 GGGAGCTGAAACCATTGAACATACTCTAAACTCACTGATGAATACACATAGCAGTC ref|XP_005098445.1| PREDICTED: uncharacterized protein C6orf62 homolog [Aplysia californica]
6 1 6 0 comp1759221_c0_seq1reverse.0 CTATTGAACAAAGAGAAGAGTCAAAGGGTACAAATGAGCAACGTGTACTATTGGCC dbj|BAE96758.1| putative 14-3-3 epsilon [Dugesia japonica]
7 1 7 0 ruditapes_c20663.0 TTATGTGTCCTGGTGAGCAATGTTATTCTGAGCACGACTTGACGCACCTGGTGTG jagged 1
8 1 8 0 Rphi_c21948.0 ATGTTTCACTTCCCCAATGTGTGTCTGGCTATCAAAGTTGTGGAGGGACACCAGA ref|XP_002157557.2| PREDICTED: uncharacterized protein LOC100201718 [Hydra vulgaris]
9 1 9 0 ruditapes2_lrc4494.0 GGCACTGCACAGAGATCTACTAGACAATTACTGCTATTGAACTGTATCGGTTTTGT ref|XP_005108000.1| PREDICTED: 60S ribosomal protein L10a-2-like [Aplysia californica]
10 1 10 0 comp389257_c0_seq2reverse.1 CCTTGACCTTCCTGACCCATAACAGGCTAAATTATGACAGTATGCAGCAAGGAAA gb|ESO96999.1| hypothetical protein LOTGIDRAFT_115354 [Lottia gigantea]
12 1 12 0 Contig4067.1 CTGAAGGAATCCATGTATTTGCGTATATTGATCCGCCATAAACCACTATAAAGGGG gb|EKC42922.1| Amiloride-sensitive amine oxidase [copper-containing] [Crassostrea gigas]
13 1 13 0 Contig2140reverse.1 GCTCTTCTACAATAACAGTTACTGTTTGGCATTTCCGACCACATAACTATTGTGCG NA
14 1 14 0 Contig8719.0 GCGGGAGGAAACACAACTTCGTGAAGAACTTGTCGCACAACAGATTAAGTATAGAG gb|EKC35375.1| Pleckstrin-like protein domain family B member 2 [Crassostrea gigas]
15 1 15 0 Rphi_rep_c38101.0 GAAGACAAGGCAACATGGAAGTCCAACTACTTCATCAAGATTGCTAAACTTTTGG gb|EKC26031.1| 60S acidic ribosomal protein P0 [Crassostrea gigas]
16 1 16 0 Rphi_rep_c51350reverse.0 GAGGAACACCCCGTACTTCTCACTGAAGCCCCTCTAAATCCTAAGGCAAATAGAGA gb|EJW72694.1| actin-2, partial [Wuchereria bancrofti]
17 1 17 0 Contig7511reverse.0 GGCACTGTGTAATCAGACATAACATATGTCCAAACAGCAGCATTAGACCAAATGT NA
18 1 18 0 comp388687_c0_seq1.0 TGGTCACAAAGTTCAAGTTGTTTCATTGTGCATCAACAATTTGGAGAAGGGGAAG gb|EKC18810.1| OTU domain-containing protein 6B [Crassostrea gigas]
19 1 19 0 comp385426_c0_seq1reverse.1 GATGGATGAACTTTCGCCTCAGAGGCTGTGTGAATTTTACAAGATTGGAGTAAAT gb|EKC18912.1| Cathepsin Z [Crassostrea gigas]
20 1 20 0 Rphi_rep_c46541reverse.0 GTGCTATGTTAGCTTTGGATTTTGAACAAGAAATGGCAACAGCTGCATCATCTAG sp|Q00215.1|ACTC_STYPL RecName: Full=Actin, cytoplasmic
21 1 21 0 comp385678_c1_seq1reverse.0 ATTGCTAAGGTCAATGCCATGTTAATAGCCAAAGGAAAGCTGAAACCTTCCCAGC gb|ACH87543.1| splicing factor 1 K-like RNA-binding domain protein [Platynereis dumerilii]gb|ACH87547.1| splicing factor 1 K-like RNA-binding domain protein [Platynereis dumerilii]

Total number of rows: 15151

Table truncated, full table size 2548 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap