| Data table |
| ID |
Probe_name |
SEQUENCE |
SPOT_ID |
GeneName |
Description |
| 1 |
GE_BrightCorner |
|
GE_BrightCorner |
|
|
| 2 |
DarkCorner |
|
DarkCorner |
|
|
| 3 |
DarkCorner |
|
DarkCorner |
|
|
| 4 |
GT_Sp_MRA_2186_33751 |
CAAGCAGTGTTTTCCGATTTGACCTTTGCCGAGCTGCCCCAGTTGGCCAATATGAACTCC |
MRA_2186 |
lppM |
MRA_2186; Gene Symbol: lppM;Product: lipoprotein LppM; Gene present in in the region 2442853..2443536 in + of length 227; Next best Hit: MRA_1465(alignment length 13bp with 100.00%identity); Genes Covered: MRA_2186 |
| 5 |
GT_Sp_MRA_3216_39717 |
CAACTGGAAACGCTGGTACGACAACAACATTCCAATCGCTGACCAGCGCTCCGAGAACTG |
MRA_3216 |
|
MRA_3216;Product: hypothetical protein; Gene present in in the region 3562530..3562874 in + of length 114; COG: COG4683S; Next best Hit: MRA_1577(alignment length 15bp with 100.00%identity); Genes Covered: MRA_3216 |
| 6 |
GT_Sp_MRA_2562_34511 |
CTTCAGACCGGAGCCCAGATCAACGTGCCGCTGTTCATCAATACCGGAGACAAACTAAAG |
MRA_2562 |
efp |
MRA_2562; Gene Symbol: efp;Product: elongation factor P; Gene present in in the region 2870695..2871258 in - of length 187; COG: COG0231J; Next best Hit: MRA_1539(alignment length 14bp with 100.00%identity); Genes Covered: MRA_2562 |
| 7 |
GT_Sp_MRA_2089_11241 |
CACAACTCGTTCAACAGCCTCAGCGATTCGTTCACGGTCTCGCACGCAGACTCAAACCAG |
MRA_2089 |
|
MRA_2089;Product: hypothetical protein; Gene present in in the region 2341316..2342779 in - of length 487; Next best Hit: MRA_0120(alignment length 14bp with 100.00%identity); Genes Covered: MRA_2089 |
| 8 |
GT_Sp_MRA_2356_15601 |
ATGATCTCTTGCTGGTTCCCTCAATAGTCGAGCCATCGAATTTTCTCGAGAATATTTCCC |
MRA_2356 |
|
MRA_2356;Product: hypothetical protein; Gene present in in the region 2620741..2621709 in + of length 322; Next best Hit: MRA_0066(alignment length 13bp with 100.00%identity); Genes Covered: MRA_2356 |
| 9 |
GT_Sp_MRA_3202_11711 |
AACATCTTTCTGATCACCGGTATCGGCTACTACCCTAACCTGGGCGTGAAAGACGCGTTC |
MRA_3202 |
|
MRA_3202;Product: hypothetical protein; Gene present in in the region 3549394..3550518 in + of length 374; Next best Hit: MRA_3922(alignment length 14bp with 100.00%identity); Genes Covered: MRA_3202 |
| 10 |
GT_Sp_MRA_0376_40227 |
GTAGTTGGTTCGCGACAGGCGCTCCTCGATAGCTGCGGAGATCTCGGCGTTGAACACCAC |
MRA_0376 |
|
MRA_0376;Product: hypothetical protein; Gene present in in the region 446189..446617 in + of length 142; Next best Hit: MRA_2409(alignment length 13bp with 100.00%identity); Genes Covered: MRA_0376 |
| 11 |
GT_Sp_MRA_1456_81 |
AACCAGCTGTTCGACCCGATCTGGAATGCGCACTACGTCGACCACGTACAGATCACCATG |
MRA_1456 |
zwf2 |
MRA_1456; Gene Symbol: zwf2;Product: glucose-6-phosphate 1-dehydrogenase; Gene present in in the region 1626728..1628272 in - of length 514; COG: COG0364G; Next best Hit: MRA_1007(alignment length 14bp with 100.00%identity); Genes Covered: MRA_1456 |
| 12 |
GT_Sp_MRA_0502_37767 |
GACGAACTCACCGAATTACTCGGGGAGAAGGCCTATGGGGAACTCGCAGCAATGTGCAAG |
MRA_0502 |
|
MRA_0502;Product: hypothetical protein; Gene present in in the region 586734..587624 in - of length 296; Next best Hit: MRA_1947(alignment length 14bp with 100.00%identity); Genes Covered: MRA_0502 |
| 13 |
GT_Sp_MRA_2654_2661 |
ATCTACTACGTCGATGCGAACGCAAGCATCCAGGAGATGCTCAACGTCATGGAAGAACAT |
MRA_2654 |
|
MRA_2654;Product: hypothetical protein; Gene present in in the region 2964530..2964961 in - of length 143; COG: COG3620K; Next best Hit: MRA_0965(alignment length 18bp with 100.00%identity); Genes Covered: MRA_2654 |
| 14 |
GT_Sp_MRA_0926_39027 |
TTGAATTGTACGCCTATCAGGCACACAATTGATGTCATGGCTACCAAGCCTGAGCGGAAG |
MRA_0926 |
|
MRA_0926;Product: hypothetical protein; Gene present in in the region 1025519..1025995 in + of length 158; COG: COG4453S; Next best Hit: MRA_2731(alignment length 12bp with 100.00%identity); Genes Covered: MRA_0926 |
| 15 |
GT_Sp_MRA_3236_27141 |
TCGTTAATGGTTGGCTTTCATGCCTTGGGTGACCCGGATGAGGAGTTCTCGTTCAGCGAC |
MRA_3236 |
nudC |
MRA_3236; Gene Symbol: nudC;Product: NADH pyrophosphatase; Gene present in in the region 3582385..3583326 in - of length 313; COG: COG2816L; Next best Hit: MRA_1265(alignment length 13bp with 100.00%identity); Genes Covered: MRA_3236 |
| 16 |
GT_Sp_MRA_3184_26401 |
GTGCACCGACAGCTGAGGGTGACAATCGGCAGCATCGTGAAAATCGGAGCGGGCTCATGA |
MRA_3184 |
nuoG |
MRA_3184; Gene Symbol: nuoG;Product: NADH dehydrogenase subunit G; Gene present in in the region 3528902..3531322 in + of length 806; COG: COG1034C; Next best Hit: MRA_0845(alignment length 14bp with 100.00%identity); Genes Covered: MRA_3184 |
| 17 |
GT_Sp_MRA_3065_18481 |
CTGAATTGCGAAATGAAGATCAAGGACCGCACGTTCAACGTCAACGTCACCGTGACCAGT |
MRA_3065 |
|
MRA_3065;Product: hypothetical protein; Gene present in in the region 3405550..3406098 in + of length 182; Next best Hit: MRA_3303(alignment length 15bp with 100.00%identity); Genes Covered: MRA_3065 |
| 18 |
GT_Sp_MRA_1751_14841 |
GAATTGGCGGCTCGAATGGGCGAGACTTTGACACAAGCGGTCGTAGTTGCAGTGCGGGAG |
MRA_1751 |
|
MRA_1751;Product: hypothetical protein; Gene present in in the region 1969223..1969435 in + of length 70; COG: COG4423S; Next best Hit: MRA_0280(alignment length 12bp with 100.00%identity); Genes Covered: MRA_1751 |
| 19 |
GT_Sp_MRA_1543_1851 |
CTTGCGAGCGGGAATTACATTGCGACAAAGTGGTTCTCATCGAACTCGTTACGGTGATAA |
MRA_1543 |
|
MRA_1543;Product: hypothetical protein; Gene present in in the region 1733990..1734556 in + of length 188; COG: COG2128S; Next best Hit: MRA_1721(alignment length 13bp with 100.00%identity); Genes Covered: MRA_1543 |
| 20 |
GT_Sp_MRA_3082_36041 |
AAGATCTATCGGCATTTCACCGACAAGTCCGATTTGCTCGAGGCTATCGGGATGCGACTG |
MRA_3082 |
|
MRA_3082;Product: transcription regulator AsnC; Gene present in in the region 3423387..3424127 in - of length 246; COG: COG1309K; Next best Hit: MRA_1896(alignment length 13bp with 100.00%identity); Genes Covered: MRA_3082 |
