NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL32387 Query DataSets for GPL32387
Status Public on Jul 22, 2022
Title FZ_IBG1_4plex_086337_all
Technology type spotted oligonucleotide
Distribution custom-commercial
Organisms Corynebacterium glutamicum; Pseudomonas putida KT2440; Bacillus subtilis subsp. subtilis str. 168; Gluconobacter oxydans 621H; Escherichia coli str. K-12 substr. MG1655
Manufacturer Agilent Technologies (Waldbronn, Germany)
Manufacture protocol see Agilent Technologies
 
Description synthesized 60mer oligonucleotides 
 
Submission date Jun 23, 2022
Last update date Jul 24, 2022
Contact name Tino Polen
E-mail(s) t.polen@fz-juelich.de
Organization name Forschungszentrum Jülich GmbH
Department IBG-1: Biotechnology
Street address Leo Brandt Str.
City Juelich
State/province NRW
ZIP/Postal code 52425
Country Germany
 
Samples (3) GSM6262951, GSM6262952, GSM6262953
Series (1)
GSE206796 Comparison of Corynebacterium glutamicum wild type with C. glutamicum ChrS-Ala245fs

Data table header descriptions
ID
Block GenePix GAL spot position Block coordinate
Column GenePix GAL spot position Column coordinate
Row GenePix GAL spot position Row coordinate
SPOT_ID Spot Name (oligo or control name)
SEQUENCE Cglutamicum_Oligo_Sequence
Gene_Annotation Cglutamicum_Gene_Annotation
ORF Cglutamicum_Lous_Tag

Data table
ID Block Column Row SPOT_ID SEQUENCE Gene_Annotation ORF
1 1 1 1 GE_BrightCorner
2 1 2 1 GE_BrightCorner
3 1 3 1 DarkCorner
4 1 4 1 DarkCorner
5 1 5 1 DarkCorner
6 1 6 1 DarkCorner
7 1 7 1 DarkCorner
8 1 8 1 DarkCorner
9 1 9 1 DarkCorner
10 1 10 1 DarkCorner
11 1 11 1 DarkCorner
12 1 12 1 DarkCorner
13 1 13 1 DarkCorner
14 1 14 1 DarkCorner
15 1 15 1 DarkCorner
16 1 16 1 DarkCorner
17 1 17 1 DarkCorner
18 1 18 1 DarkCorner
19 1 19 1 DarkCorner
20 1 20 1 IGR_PP_3648 CACTTGGCTGATACATCTTGAGTCGATGTTGGCATCTTCGCGGGCTTG

Total number of rows: 45220

Table truncated, full table size 4753 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL32387_FZ_IBG1_4plex_086337_all.gal.gz 534.8 Kb (ftp)(http) GAL

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap