NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL3828 Query DataSets for GPL3828
Status Public on Jun 02, 2006
Title DGRC-D. melanogaster-DGRC1-15552-v3
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Drosophila melanogaster
Manufacturer Drosophila Genomics Resource Center (DGRC)
Manufacture protocol http://dgrc.cgb.indiana.edu/microarrays/support/protocols.html
Catalog number DGRC-1
Support glass
Coating aminosilane
 
Description DGRC-1 amplicon transcriptome microarrays are spotted with DNA fragments amplified from genomic DNA of the Oregon R strain of Drosophila melanogaster using gene-specific oligonucleotide primer pairs made by Incyte Genomics. The primers were designed against release 1 of the annotated genome sequence and were selected to amplify fragments which have minimal sequence similarity to other genes, size range between 100-600 bp, and location biased towards the 3'-end of transcripts. The array also contains the following controls: a ubiquitously expressed gene (actin 5C), a spotting buffer-only control (3XSSC plus 1.5M Betaine), exogenous(non-Drosophila) probes (7 from Arabidopsis and 8 Ambion array control PCR spots from bacteria that can be used with spiking RNAs), and three exogenous markers: GAL4, lacZ, and FLP. The DGRC arrays are printed using an Omnigrid 300 contact-printing instrument and 48 silicon split-pins on Corning GAPS II slides.
 
Web link http://dgrc.cgb.indiana.edu/microarrays/platforms.html
Contributor(s) Andrews J, Cherbas P, Bogart K, Sentmanat M, Costello J, Burr A
Submission date May 31, 2006
Last update date Jun 02, 2006
Organization Drosophila Genomics Resource Center (DGRC)
E-mail(s) dgrc@cgb.indiana.edu
Phone 812-855-5510
URL http://dgrc.cgb.indiana.edu/
Department Indiana University
Lab Center for Genomics and Bioinformatics (CGB)
Street address 1001 E. 3rd St.
City Bloomington
State/province IN
ZIP/Postal code 47405
Country USA
 

Data table header descriptions
ID
MetaColumn The column location of the block or sub-array of the probe on the microarray
MetaRow The row location of the block or sub-array of the probe on the microarray
Column The column location of probe within block
Row The row location of probe within block
Reporter Identifier Identification for probes on the microarray
Reporter Name Name for probes on the microarray
CLONE_ID The primary flybase id(FBgn) for a gene
ORF The primary flybase id(FBgn) for a gene
Reporter BioSequence Type The probe type telling how the probe was generated.
Reporter BioSequence Polymer Type The polymer type of probes on the microarray
Reporter Group [role] Column to identify probes as experimental or control.
Reporter Control Type Column to specify the type of control for control spots.
Reporter comment Additional information about the probe.
Reporter Biosequence [Forward Primer] The sequence of the forward primer used for PCR amplification.
Reporter Biosequence [Reverse Primer] The sequence of the reverse primer used for PCR amplification.
SPOT_ID

Data table
ID MetaColumn MetaRow Column Row Reporter Identifier Reporter Name CLONE_ID ORF Reporter BioSequence Type Reporter BioSequence Polymer Type Reporter Group [role] Reporter Control Type Reporter comment Reporter Biosequence [Forward Primer] Reporter Biosequence [Reverse Primer] SPOT_ID
1 1 1 1 1 CONv03I12 T:Scer\GAL4|==|FBgn0026021 FBgn0026021 PCR_amplicon DNA Control control_biosequence Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. TGTGCCATTGAAATCAGGAG GTTATACGCAGTTTGGTCCG
2 1 1 2 1 CONv03A24 Act5C|==|FBgn0000042 FBgn0000042 CG4027 PCR_amplicon DNA Control control_biosequence Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. GTTCGAGACCTTCAACACAC CTTACGGATATCCACATCACAC
3 1 1 3 1 CONv03I12 T:Scer\GAL4|==|FBgn0026021 FBgn0026021 PCR_amplicon DNA Control control_biosequence Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. TGTGCCATTGAAATCAGGAG GTTATACGCAGTTTGGTCCG
4 1 1 4 1 CONv03E24 T:Ecol\lacZ|==|FBgn0015311 FBgn0015311 PCR_amplicon DNA Control control_biosequence Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. CGCAAGAAAACTATCCCGAC CACCAGACCAACTGGTAATG
5 1 1 5 1 CONv03I12 T:Scer\GAL4|==|FBgn0026021 FBgn0026021 PCR_amplicon DNA Control control_biosequence Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. TGTGCCATTGAAATCAGGAG GTTATACGCAGTTTGGTCCG
6 1 1 6 1 CONv03I24 Scer\FLP1|==|FBgn0014444 FBgn0014444 PCR_amplicon DNA Control control_biosequence Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. TTTCAATGAAGGGCCTAACG GGTAGTCTAGTACCTCCTGTG
7 1 1 7 1 CONv03M12 no_primer|==|null genomic_DNA DNA Control control_genomic_DNA -- CONTROL
8 1 1 8 1 CONv03M24 spotting_soln|==|null Control control_buffer -- CONTROL
9 1 1 9 1 INC002A06 CG14615|==|FBgn0031184 FBgn0031184 CG14615 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. CGAACTGCTTGATCTATACAAAGT GAGATAAGTGAGTGAGCCTTCA
10 1 1 10 1 INC002A12 CG17108|==|FBgn0032285 FBgn0032285 CG17108 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. ATCTTCAGTTGGAGTTATTGGTG GAGAATTACAGGTATATTGGGCTT
11 1 1 11 1 INC002C06 CG8533|==|FBgn0036907 FBgn0036907 CG8533 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. CGACATTATATTGACCACTGTGTA TATCTAGGTTCGTTTTCTCAGATG
12 1 1 12 1 INC002C12 dpld|==|FBgn0015930 FBgn0015930 CG1624 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. AGGTTGGAGTGAAGATTTTGAG AAGCGAACGAGAAATCGAAAAA
13 1 1 13 1 INC002E06 &bgr;4GalTA|==|FBgn0027538 FBgn0027538 CG8536 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. AACTTTCACTTGGTACTTAGCAGA ACCTTGTAGGAATAGGTGTAGCTT
14 1 1 14 1 INC002E12 Arpc3B|==|FBgn0065032 FBgn0065032 CG8936 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. TCATCTACATAACGCTCTACATCA AAAGACTCTTCTCCATGAACTTCT
15 1 1 15 1 INC002G06 CG14101|==|FBgn0036905 FBgn0036905 CG14101 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. CACATAAACCACCAACTCTATACC GGCGTATTAGTTGTAATCACATTG
16 1 1 16 1 INC002G12 Toll-7|==|FBgn0034476 FBgn0034476 CG8595 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. ACTATCAGCTATTAGAGGCAACAA CATTTACTGGTACAACTTGTGGA
17 1 1 17 1 INC006A06 CG2121|==|FBgn0033289 FBgn0033289 CG2121 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. GAGTAAAGCGCGGAGACACT ACAACCAGCCAGACTCCATC
18 1 1 18 1 INC006A12 CG31612|==|FBgn0051612 FBgn0051612 CG31612 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. ATTTGAAGTCGGATTTGGAG AATGAATGAATGCAATGTGG
19 1 1 1 2 INC006C06 trh|==|FBgn0003749 FBgn0003749 CG6883 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. GATAGGCACTCCCTACCAAC ATTACTGTAGGTAACTCCACCCTC
20 1 1 2 2 INC006C12 Ets96B|==|FBgn0039225 FBgn0039225 CG6892 PCR_amplicon DNA Experimental Reporter BioSequence DatabaseEntry are based on Drosophila melanogaster genome annotation v4.1. CAGGCTCTCACCCACTTGAC CAGGAGGGCCACCAGAAACT

Total number of rows: 15552

Table truncated, full table size 3568 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap