NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4552 Query DataSets for GPL4552
Status Public on Nov 18, 2006
Title Array designs: Chromosome II
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Caenorhabditis elegans
Manufacturer NimbleGen Systems Inc.
Manufacture protocol see NimbleGen website at http://www.nimblegen.com
50-mers oligos were used.
 
 
Submission date Nov 10, 2006
Last update date Dec 11, 2007
Contact name Donald Moerman
Organization name University of British Columbia
Department Michael Smith Laboratories
Street address 301 - 2185 East Mall
City Vancouver
State/province British Columbia
ZIP/Postal code V6T 1Z4
Country Canada
 
Samples (4) GSM144676, GSM144677, GSM380169, GSM380170
Series (2)
GSE6294 Efficient High-Resolution Discovery in C. elegans by Array Comparative Genomic Hybridization
GSE15224 Oligoarray comparative genomic hybridisation-mediated mapping of suppressors of an essential receptor tyrosine kinase generated in a deletion-biased mutagenesis screen

Data table header descriptions
ID
PROBE_DESIGN_ID This a unique, composite key consisting of the DESIGN ID, ROW NUM and COL NUM.
CONTAINER NimbleGen arrays are divided into containers. One method of using containers is to divide the array into quadrants with reference marks. Will be used as ‘GENE EXPR OPTION’ for PAIR and CALLS reports.
DESIGN_NOTE A comment field suitable for placing information necessary for data analysis, for instance if you want to analyze sets of probes and/or genes together that don’t separate out using SEQ ID, PROBE ID, SELECTION CRITERIA, CONTAINER, or other information.
SELECTION_CRITERIA Generally contains information about how a probe was selected. For rank selection, contains rank, uniqueness, and frequency. For older designs, will contain a criteria category.
SEQ_ID The NimbleGen sequence identifier. Used to group the probe pairs together for determing gene expression summary values.
SEQUENCE The DNA sequence synthesized on the array. Always shown 5’ to 3’.
MISMATCH The mismatch index of the PROBE SEQUENCE. This will be 0 (for the perfect match probe), 1 for the first mismatch, 2 for the next, etc.
MATCH_INDEX Integer number that ties probe pairs together. Using the combination of MATCH INDEX and MISMATCH you can retrieve and distinguish the members of the probe pair.
FEATURE_ID Unsigned Integer that uniquely identifies a feature. A feature is the set of probes on the array that are to be considered as one entity. A 4:9 array will have 4 probes with the same FEATURE ID.
ROW_NUM The Y or row coordinate of the feature in the CONTAINER.
COL_NUM The X or column coordinate of the feature in the CONTAINER.
PROBE_CLASS Designates probe purpose.
POSITION Position of the PROBE SEQUENCE in the sequence/region of interest, starting from the left/5’ end.
DESIGN_ID This is the NimbleGen identifier for the design.
X The X or column coordinate of the feature in the design.
Y The Y or row coordinate of the feature in the design.
GENOME_BUILD_NUMBER Genome Build Number

Data table
ID PROBE_DESIGN_ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQ_ID SEQUENCE MISMATCH MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS POSITION DESIGN_ID X Y GENOME_BUILD_NUMBER
CHR200P04469997 3364_0001_0001 BLOCK1 II_4469997|W06B4.2|+|exon:5 CHR2 AGAAGGAACCAATTTCTTTTTGACGGATCACACGATCGTTTGCAAACGAA 0 60713776 60713776 1 1 4469997 3364 1 1 WS150
CHR200P10111955 3364_0023_0001 BLOCK1 II_10111955|ZK945.9|-|exon:7 CHR2 GAAGATGATACTGACAGAATAGTCTTGCCTTGACACTCGATCCCTCAACC 0 60886836 60886836 1 23 10111955 3364 23 1 WS150
CHR200P04521474 3364_0025_0001 BLOCK1 II_4521474|B0304.1b|+|exon:3 CHR2 ACCAGCATTTGCAGATGACACAGCAGATTAATGGAGCTCCACCTCACGAT 0 60714945 60714945 1 25 4521474 3364 25 1 WS150
CHR200P08085771 3364_0027_0001 BLOCK1 II_8085771|K02C4.3|-|exon:8 CHR2 TAATTGAGCATGAAGTGCAGCATCAAATGCTCTCTGTAGCCAATCGAAGA 0 60823817 60823817 1 27 8085771 3364 27 1 WS150
CHR200P14596763 3364_0029_0001 BLOCK1 II_14596763|C01G12.8|+|exon:7 CHR2 CTGTTCGGTCTTCCACTTCCAATGTCCATCATCGCCATTCTCATGATCGA 0 60991533 60991533 1 29 14596763 3364 29 1 WS150
CHR200P07818111 3364_0031_0001 BLOCK1 II_7818111|T05A6.2b|+|exon:5 CHR2 TCGTTCGCCACCAGCCAAGAAGATGACTACCTCGACTCGTCGTTCTCGTC 0 60814986 60814986 1 31 7818111 3364 31 1 WS150
CHR200P14162391 3364_0033_0001 BLOCK1 II_14162391|Y48B6A.3|+|exon:4 CHR2 TGAAGGACCAAAAGATGACATTCGTCTCTACGAATCAGGCTGGAAGGATC 0 60981810 60981810 1 33 14162391 3364 33 1 WS150
CHR200P09644087 3364_0035_0001 BLOCK1 II_9644087|ZK1307.6|-|exon:5 CHR2 TATTTGATTGACGTAGAGGCATAAATCGATCCCCGTAAGGATTCGCTCCT 0 60873794 60873794 1 35 9644087 3364 35 1 WS150
CHR200P06792969 3364_0037_0001 BLOCK1 II_6792969|T13C2.2|+|exon:4 CHR2 CTCTTCCCTCGTCTTATCAACGACAAATTCTTGAAATTTTAAAAGAAACT 0 60783317 60783317 1 37 6792969 3364 37 1 WS150
CHR200P14679957 3364_0039_0001 BLOCK1 II_14679957|ZC101.3|+|exon:5 CHR2 CATATTTTTCCATTTGAAGTACGCAGTCATTTTTGGGCTTCCAACACTTT 0 60994617 60994617 1 39 14679957 3364 39 1 WS150
CHR200P01440800 3364_0041_0001 BLOCK1 II_1440800|Y51H7C.12|-|exon:2 CHR2 ACTGCATAAATAACTCATGATTGTTGAGTCGGGGCTTTGAAATGTCAGCA 0 60652650 60652650 1 41 1440800 3364 41 1 WS150
CHR200P09161872 3364_0043_0001 BLOCK1 II_9161872|W07A12.7|+|exon:2 CHR2 AGTGAAGGAAGAATTGATATTTTGGATCGACTACCATCTGCTGATGCATT 0 60858940 60858940 1 43 9161872 3364 43 1 WS150
CHR200P09198772 3364_0045_0001 BLOCK1 II_9198772|ZK1067.1|+|upstream:2 CHR2 AACCAAAATATGCATCCCCTCTGTGAATTTTTCCTCTTTGAATCAAACAA 0 60860187 60860187 1 45 9198772 3364 45 1 WS150
CHR200P13725595 3364_0047_0001 BLOCK1 II_13725595|Y54G9A.7|-|exon:1 CHR2 GAATCGATGAAGTTGGTGGAGGACGGAAGAAATGCATTTGAGAGCGCTGA 0 60974533 60974533 1 47 13725595 3364 47 1 WS150
CHR200P02096808 3364_0051_0001 BLOCK1 II_2096808|T16A1.2|+|exon:2 CHR2 GAATGTGAAACCATTCTATAAGTTGGCCGAGATTTCCGAATATATCGTAA 0 60664743 60664743 1 51 2096808 3364 51 1 WS150
CHR200P06050454 3364_0053_0001 BLOCK1 II_6050454|R12C12.1a|+|exon:1 CHR2 ATGATTGTACGACACCTTCAATATGATGCTTTTGTTGATAGACATATTGG 0 60759445 60759445 1 53 6050454 3364 53 1 WS150
CHR200P11457058 3364_0055_0001 BLOCK1 II_11457058|W02B12.4|-|exon:5 CHR2 CCCATCAGAACTTTCTGATTTTGGGTGTTTTTGACCATGTTATCAGGGAT 0 60925314 60925314 1 55 11457058 3364 55 1 WS150
CHR200P10213422 3364_0165_0001 BLOCK1 II_10213422|T01E8.2|+|upstream:1 CHR2 AGGGTTTCCAATTTGCAACGCTCCATACTGAGAGCCCCTGTAATTCAGAA 0 60890246 60890246 1 165 10213422 3364 165 1 WS150
CHR200P08881326 3364_0167_0001 BLOCK1 II_8881326|T07D4.3|-|exon:8 CHR2 TGACATTGCTGTTTTCAGTGATTCGTTGATTGATGGATCTGTTAGAATAT 0 60850409 60850409 1 167 8881326 3364 167 1 WS150
CHR200P11629175 3364_0169_0001 BLOCK1 II_11629175|F07A11.6c|-|exon:15 CHR2 GAACTCGAACCTTGATCATTTTCAGATTTACTTGTAGGTGACGATGATCT 0 60931989 60931989 1 169 11629175 3364 169 1 WS150

Total number of rows: 387187

Table truncated, full table size 68061 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap