NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4553 Query DataSets for GPL4553
Status Public on Nov 18, 2006
Title Array designs: Whole Genome
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Caenorhabditis elegans
Manufacturer NimbleGen Systems Inc.
Manufacture protocol see NimbleGen website at http://www.nimblegen.com
50-mers oligos were used.
 
 
Submission date Nov 10, 2006
Last update date Dec 11, 2007
Contact name Donald Moerman
Organization name University of British Columbia
Department Michael Smith Laboratories
Street address 301 - 2185 East Mall
City Vancouver
State/province British Columbia
ZIP/Postal code V6T 1Z4
Country Canada
 
Samples (34) GSM144678, GSM144679, GSM229955, GSM233090, GSM233091, GSM233092 
Series (4)
GSE6294 Efficient High-Resolution Discovery in C. elegans by Array Comparative Genomic Hybridization
GSE9214 CGH mapping of Genetic Deficiencies balanced by hT2 and eT1 on LGIII
GSE14036 High-resolution array comparative genomic hybridization of genetic deficiencies on chromosome V in C. elegans

Data table header descriptions
ID
PROBE_DESIGN_ID This a unique, composite key consisting of the DESIGN ID, ROW NUM and COL NUM.
CONTAINER NimbleGen arrays are divided into containers. One method of using containers is to divide the array into quadrants with reference marks. Will be used as ‘GENE EXPR OPTION’ for PAIR and CALLS reports.
DESIGN_NOTE A comment field suitable for placing information necessary for data analysis, for instance if you want to analyze sets of probes and/or genes together that don’t separate out using SEQ ID, PROBE ID, SELECTION CRITERIA, CONTAINER, or other information.
SELECTION_CRITERIA Generally contains information about how a probe was selected. For rank selection, contains rank, uniqueness, and frequency. For older designs, will contain a criteria category.
SEQ_ID The NimbleGen sequence identifier. Used to group the probe pairs together for determing gene expression summary values.
SEQUENCE The DNA sequence synthesized on the array. Always shown 5’ to 3’.
MISMATCH The mismatch index of the PROBE SEQUENCE. This will be 0 (for the perfect match probe), 1 for the first mismatch, 2 for the next, etc.
MATCH_INDEX Integer number that ties probe pairs together. Using the combination of MATCH INDEX and MISMATCH you can retrieve and distinguish the members of the probe pair.
FEATURE_ID Unsigned Integer that uniquely identifies a feature. A feature is the set of probes on the array that are to be considered as one entity. A 4:9 array will have 4 probes with the same FEATURE ID.
ROW_NUM The Y or row coordinate of the feature in the CONTAINER.
COL_NUM The X or column coordinate of the feature in the CONTAINER.
PROBE_CLASS Designates probe purpose.
POSITION Position of the PROBE SEQUENCE in the sequence/region of interest, starting from the left/5’ end.
DESIGN_ID This is the NimbleGen identifier for the design.
X The X or column coordinate of the feature in the design.
Y The Y or row coordinate of the feature in the design.
GENOME_BUILD_NUMBER Genome Build Number

Data table
ID PROBE_DESIGN_ID CONTAINER DESIGN_NOTE SELECTION_CRITERIA SEQ_ID SEQUENCE MISMATCH MATCH_INDEX FEATURE_ID ROW_NUM COL_NUM PROBE_CLASS POSITION DESIGN_ID X Y GENOME_BUILD_NUMBER
CHRX00P02546212 2153_0001_0001 FORWARD X_2546212|F52H2.4|-|exon:6 CHRX TTTTGAAGTGACATCCATCACGAAACGTGGCAACAGTTCATTTGCATTTC 0 38839867 38839867 1 1 2546212 2153 1 1 WS139
CHR200P14650026 2153_0025_0001 FORWARD II_14650026|ZC101.2e|-|exon:8 CHR2 TGATGATTGTTGGCGTTCCTGCAGTTGGCTCCGTTCAAGCAGAGGTTTGT 0 38631917 38631917 1 25 14650026 2153 25 1 WS139
CHRX00P13393024 2153_0027_0001 FORWARD X_13393024|F02C12.4|-|exon:5 CHRX AGAAATCGAGCCGAGTGTACGATGTTCCGGTGACTTGAATACAACCATTG 0 38879025 38879025 1 27 13393024 2153 27 1 WS139
CHR400P10669472 2153_0029_0001 FORWARD IV_10669472|K08C7.3a|+|exon:4 CHR4 GTGATATTGGAGGTGCTTTGAGAGCTGAATGTGACATCACATCAGGACAA 0 38728560 38728560 1 29 10669472 2153 29 1 WS139
CHRX00P14812380 2153_0031_0001 FORWARD X_14812380|T04C10.3|+|exon:1 CHRX TGATTGAAAACTCATATGAAGACTGTTTTTCAAAGGTGAAAGTACCAGAC 0 38884360 38884360 1 31 14812380 2153 31 1 WS139
CHR300P05871353 2153_0033_0001 FORWARD III_5871353|F01F1.11|-|exon:6 CHR3 ATGTGGCTTCAGATATTCCGCAACGGATGGTTCTCTCCAATGAAGCTTCA 0 38656202 38656202 1 33 5871353 2153 33 1 WS139
CHR100P04003901 2153_0035_0001 FORWARD I_4003901|F55C7.7c|-|exon:11 CHR1 TATTTTCCATCGGTGGGGGTAGGCAATCCTCGGCCTTCTCGTCTTCTGCA 0 38519724 38519724 1 35 4003901 2153 35 1 WS139
CHR200P03143455 2153_0037_0001 FORWARD II_3143455|T10D4.10|-|exon:1 CHR2 CAGTCTACGCATTAGAAAATTTCGGTACGGTGGAGTAGATGCAAGTAGAA 0 38580548 38580548 1 37 3143455 2153 37 1 WS139
CHR200P13994335 2153_0039_0001 FORWARD II_13994335|Y39G8B.7|-|exon:1 CHR2 TTAAAGAATCATTGAGAACTCTTTATTGAAGCTCAGAAGTTTCTCGAAAC 0 38629419 38629419 1 39 13994335 2153 39 1 WS139
CHR300P06598127 2153_0041_0001 FORWARD III_6598127|F20H11.2|-|exon:10 CHR3 TGCATATGTCTTGCCTGAATAACGCCAGCCCCCGGTGTCTTGGCTTGTAT 0 38660263 38660263 1 41 6598127 2153 41 1 WS139
CHRX00P01314471 2153_0043_0001 FORWARD X_1314471|H42K12.3|+|exon:7 CHRX GATCAAGAAGCACCCAAAGAACTTTGGATCCAAGACTTATGAGATTCTGA 0 38836396 38836396 1 43 1314471 2153 43 1 WS139
CHR200P12495811 2153_0045_0001 FORWARD II_12495811|T21B4.3|-|exon:2 CHR2 TAAGAAAAATGACATTCTGTGCATCTACCGGAGTATTTTCACAAGTATAG 0 38624891 38624891 1 45 12495811 2153 45 1 WS139
CHR500P03908091 2153_0047_0001 FORWARD V_3908091|T20C7.2|+|exon:3 CHR5 AACACATTCGAGAAATCCGCCCGCGTGCTGACTTGGCCAGAACTTTCGAG 0 38762954 38762954 1 47 3908091 2153 47 1 WS139
CHR100P06154473 2153_0049_0001 FORWARD I_6154473|F56F4.2|+|exon:2 CHR1 AAATGGAGATGGATGTTCCAGCGGAATTCAGGAATTATGAGAAATACCCG 0 38530925 38530925 1 49 6154473 2153 49 1 WS139
CHR200P06253298 2153_0051_0001 FORWARD II_6253298|F13H8.5|-|exon:2 CHR2 AGAATTATGCACCTTACGTCCCTTGCAGCACTGGAGGAATTTTGCACTGG 0 38594107 38594107 1 51 6253298 2153 51 1 WS139
CHR300P10317901 2153_0053_0001 FORWARD III_10317901|T07A5.2|-|exon:4 CHR3 TACTGTCCCGGAGACGTGTAACCACTTCTCGCCGGCTCGTATCGAAAGTT 0 38678920 38678920 1 53 10317901 2153 53 1 WS139
CHR300P03957242 2153_0055_0001 FORWARD III_3957242|F37A8.5|+|exon:3 CHR3 CGGTTGCCGATATTTATTGCGAGATCTGCAAAACGACGTTGGGATGGAAA 0 38645635 38645635 1 55 3957242 2153 55 1 WS139
CHRX00P13048429 2153_0165_0001 FORWARD X_13048429|C53C7.3|+|upstream:1 CHRX GACGAGCACTCATTTACTCGACTAATACTTTATAACTACAATCTACTCAG 0 38877770 38877770 1 165 13048429 2153 165 1 WS139
CHRX00P13151883 2153_0167_0001 FORWARD X_13151883|F09A5.3|+|exon:5 CHRX GAAATTCAACGCATTGAATTTACAAGAGAGTGTATCCACGAGTTTATTCA 0 38878206 38878206 1 167 13151883 2153 167 1 WS139
CHR500P14586899 2153_0169_0001 FORWARD V_14586899|Y40H4A.2|-|exon:5 CHR5 CACAGGAACAAATGATCTGGATACAAGCAATGATAGGCCATCAGAAGCAT 0 38811825 38811825 1 169 14586899 2153 169 1 WS139

Total number of rows: 388468

Table truncated, full table size 68660 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap