NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4574 Query DataSets for GPL4574
Status Public on Mar 01, 2007
Title Conway Institute Candida parapsilosis 3851 v1.0
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Candida parapsilosis
Manufacturer University College Dublin, Conway Institute
Manufacture protocol Oligonucleotides were designed from the genome sequence survey of C. parapsilosis CLIB214 (Logue, M. E., S. Wong, K. H. Wolfe, and G. Butler. 2005. A genome sequence survey shows that the pathogenic yeast Candida parapsilosis has a defective MTLa1 allele at Its Mating Type Locus. Eukaryot Cell 4:1009-1017).
Oligonucleotides were synthesized by Operon Biotechnologies and resuspended in printing buffer from Genetix at a final concentration of 50 µM. In total, 3851 oligonucleotides representing 3849 putative genes and the 2 positive controls were printed in duplicate on UltraGAPS coated slides (Corning) using a Q-array robot (Genetix) controlled with Qsoft software (Genetix). The general design is 2 subarrays of 16 blocks each, with all oligonucleotides spotted in duplicate, one copy per block. The slides were air dried for 2 days and DNA was cross-linked to the slide by UV at 6200 mJ cm-2 in an UV-linker (Stratagene). The slides were pre-soaked in a solution consisting of 75 % PBS, 25 % ethanol and 0.5% sodium borohydride (Alfa Aesar) for 4 h at 42ºC to remove potential spot autofluorescence. The slides were subsequently washed 3 times in water, 1 time in isopropanol, dried, and stored.
Support glass
Coating aminosilane
 
 
Contributor(s) Butler G, Rossignol T, Logue ME
Submission date Nov 20, 2006
Last update date Jan 18, 2013
Contact name Geraldine Butler
E-mail(s) geraldine.butler@ucd.ie
Organization name University Colege Dublin Conway Institute
Department School of Biomolecular and Biomedical Science
Lab Butler lab
Street address Belfield
City Dublin
ZIP/Postal code D4
Country Ireland
 
Samples (10) GSM146275, GSM146276, GSM146277, GSM146278, GSM146279, GSM146280 
Series (3)
GSE6318 Analysis of the transcriptional response of Candida parapsilosis following exposure to farnesol
GSE13717 Transcriptional profile of Candida parapsilosis in SD media
GSE13832 Hypoxia and biofilms in Candida parapsilosis

Data table header descriptions
ID
CGD ortholog ORF19 Candida Genome Database ortholog ORF19 ID
CGD ortholog ID Candida Genome Database ortholog ID
CGD ortholog description Candida Genome Database ortholog description
SGD ortholog ID Saccharomyces Genome Database ortholog ID
SGD ortholog name Saccharomyces Genome Database ortholog name
SGD ortholog description Saccharomyces Genome Database ortholog description
Ortholog ORF19 ID GenBank GenBank ortholog ORF19 ID
Ortholog Gene Name GenBank GeneBank ortholog name
Ortholog Product GenBank GeneBank ortholog product
Ortholog Description GenBank GeneBank ortholog description
SEQUENCE Oligonuleotide sequence
SPOT_ID spot identifier

Data table
ID CGD ortholog ORF19 CGD ortholog ID CGD ortholog description SGD ortholog ID SGD ortholog name SGD ortholog description Ortholog ORF19 ID GenBank Ortholog Gene Name GenBank Ortholog Product GenBank Ortholog Description GenBank SEQUENCE SPOT_ID
5100 CaO19.5618 CAL0000568 Predicted ORF from Assembly 19 YGL095C VPS45 Protein of the Sec1p/Munc-18 family, essential for vacuolar protein sorting; required for the function of Pep12p and the early endosome/late Golgi SNARE Tlg2p; essential for fusion of Golgi-derived vesicles with the prevacuolar compartment CaO19.5618 VPS45 hypothetical protein Sec1 family essential for vacuolar protein sorting TAGCCTATTCAAAGTGAAACAAACATACTTTGACAAATTATTCAAATCGAATGCACCTGACGTAAACT Ortholog of Candida albicans locus: CaO19.5618
5102 CaO19.5211 CAL0003500 Protein described as isocitrate dehydrogenase; transcriptionally induced by interaction with macrophage; alkaline upregulated YDL066W IDP1 Mitochondrial NADP-specific isocitrate dehydrogenase, catalyzes the oxidation of isocitrate to alpha-ketoglutarate; not required for mitochondrial respiration and may function to divert alpha-ketoglutarate to biosynthetic processes CaO19.5211 IDP1 hypothetical protein Mitochondrial NADP-specific isocitrate dehydrogenase ATATGGTTGCCCAAATGATTAAATCACAAGGTGGTTTTGTTATGGCTTTGAAGAATTATGACGGAGAT Ortholog of Candida albicans locus: CaO19.5211
5103 CaO19.7041 CAL0002053 Predicted ORF from Assembly 19 YAL043C PTA1 Subunit of holo-CPF, a multiprotein complex and functional homolog of mammalian CPSF, required for the cleavage and polyadenylation of mRNA and snoRNA 3' ends; involved in pre-tRNA processing; binds to the phosphorylated CTD of RNAPII CaO19.7041 PTA1 hypothetical protein pre-tRNA processing TAGAGAAGGGCACGACGTTGAGACTTTTGGCAAGTTGATTGATATCTCATTGATTGTTTACAAGTTGG Ortholog of Candida albicans locus: CaO19.7041
5104 CaO19.5389 CAL0004415 Forkhead transcription factor; morphogenesis regulator; required for wild-type hyphal transcription, cell separation, and for virulence in cell culture; mutant lacks true hyphae, is constitutively pseudohyphal YNL068C FKH2 Transcription factor of the forkhead family that regulates the cell cycle and pseudohyphal growth; also involved in chromatin silencing at HML and HMR; potential Cdc28p substrate CaO19.5389 FKH2 potential forkhead-like transcriptional regulator potential forkhead-like transcription factor similar to S. cerevisiae FKH2 (YNL068C) involved in pseudohyphal growth GTTATGCATACTACAGATTTTCTAAAACTGGTTGGCAAAATTCAATTAGACATAATTTATCATTAAAC Ortholog of Candida albicans locus: CaO19.5389
5105 CaO19.5440 CAL0005257 Predicted ORF from Assembly 19 YDL007W RPT2 One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degradation of ubiquitinated substrates; required for normal peptide hydrolysis by the core 20S particle CaO19.5440 RPT2 likely proteasome regulatory particle ATPase Rpt2p likely ATPase similar to S. cerevisiae RPT2 (YDL007W) ATPase subunit of the 19S regulatory particle of the 26S proteasome GTCGCAAATACAAGAAATCAAGGAATCGGTTGAGTTGCCGTTGACACACCCAGAGTTGTATGAAGAAA Ortholog of Candida albicans locus: CaO19.5440
5106 CaO19.5307 CAL0004249 Predicted ORF from Assembly 19 YKL217W JEN1 Lactate transporter, required for uptake of lactate and pyruvate; expression is derepressed by transcriptional activator Cat8p under nonfermentative growth conditions, and repressed in the presence of glucose, fructose, and mannose CaO19.5307 JEN2 potential lactate/pyruvate transporter one of two genes similar to S. cerevisiae JEN1 (YKL217W) lactate and pyruvate transporter TGTCCAAACTTATGCGCAATTCCTCGGTGCTCGTGCAATCTTTGGTATCTTAATGGGAAGTATGTTGC Ortholog of Candida albicans locus: CaO19.5307
5107 CaO19.6070 CAL0005183 Described as sodium transporter; transcription is upregulated in response to treatment with ciclopirox olamine; alkaline upregulated by Rim101p; repressed upon high-level peroxide stress YDR038C ENA5 Protein with similarity to P-type ATPase sodium pumps CaO19.6070 ENA2 hypothetical protein P-type ATPase, Na+ efflux GTTATTGTGAGAAAGTTGGATTCGTTAGAGGCTTTGGGTGGAATCAACGATATATGTTCCGATAAGAC Ortholog of Candida albicans locus: CaO19.6070
5108 CaO19.2365 CAL0000768 Protein described as DNA polymerase epsilon; transcriptionally induced by interaction with macrophage; transcription is regulated by Tup1p YNL262W POL2 Catalytic subunit of DNA polymerase epsilon, one of the major chromosomal DNA replication polymerases characterized by processivity and proofreading exonuclease activity; also involved in DNA synthesis during DNA repair CaO19.2365 POL2 hypothetical protein DNA polymerase II (epsilon) large subunit TGCAATGTCAAGAGTTTTGGACGAGTCACAAAGGAAGACTTATCACTACCGAATCATTTGCTTGGATT Ortholog of Candida albicans locus: CaO19.2365
5109 CaO19.1366 CAL0003886 Predicted ORF from Assembly 19 CaO19.1366 hypothetical protein weak similarity to apple flavonol synthase; Fe II, 2-oxoglutarate-dependent dioxygenases TTTATCATTGTACAAAGAGGGTCCCGAAAATCTTTCCACAAGGAAGGGATTAGCTGACAAGATTGAGA Ortholog of Candida albicans locus: CaO19.1366
5110 CaO19.339 CAL0004762 Putative NADH dehydrogenase that could act alternatively to complex I in respiration; caspofungin repressed; fungal-specific (no human or murine homolog) YMR145C NDE1 Mitochondrial external NADH dehydrogenase, catalyzes the oxidation of cytosolic NADH; Nde1p and Nde2p are involved in providing the cytosolic NADH to the mitochondrial respiratory chain CaO19.339 NDE1 potential mitochondrial nonproton-pumping NADH dehydrogenase one of two genes similar to S. cerevisiae mitochondrial nonproton-pumping NADH dehydrogenases NDE1 (YMR145C), NDE2 (YDL085W) and NDI1 (YML120C) TATTTTGCCAAAGAGTGACCCAGAACGTAAGAGATTGCTACAAATTGTTGTTTGTGGAGGTGGCCCAA Ortholog of Candida albicans locus: CaO19.339
5111 CaO19.2337 CAL0000727 Putative high-affinity basic amino acid permease; fungal-specific (no human or murine homolog) YNL268W LYP1 Lysine permease; one of three amino acid permeases (Alp1p, Can1p, Lyp1p) responsible for uptake of cationic amino acids CaO19.2337 LYP2 likely basic amino acid permease likely amino acid permease similar to several bacterial lysine permeases and also to S. cerevisiae LYP1 (YNL268W), ALP1 (YNL270C) and CAN1 (YEL063C) basic amino acid permeases GAATGTACCTTATGATTACCCTAATTTACTGACAAAGACTGTTGCAGTATCACCATTCACAATTGTGT Ortholog of Candida albicans locus: CaO19.2337
5112 CaO19.1826 CAL0001630 Putative transcription factor with zinc finger DNA-binding motif CaO19.1826 hypothetical protein similar to hypothetical protein ACATGTACAATGATGAGGATAATTCATTTGTTACTCCACAATTTGTTATGGCTAATGAGCAATTTGCC Ortholog of Candida albicans locus: CaO19.1826
5113 CaO19.5970 CAL0003422 Protein described as a DNA repair helicase; transcriptionally induced by interaction with macrophage; fungal-specific (no human or murine homolog) YJL092W HPR5 DNA helicase and DNA-dependent ATPase involved in DNA repair, required for proper timing of commitment to meiotic recombination and the transition from Meiosis I to Meiosis II; potential Cdc28p substrate CaO19.5970 HPR5 potential DNA repair helicase similar to S. cerevisiae HPR5 (YJL092W) DNA helicase involved in double strand break repair GAAAACTAAAGAATTGGTGTCTCAATTTAAAGATTCGATAAAGCCCGTTTACAGGTGTCTAAAGTCAG Ortholog of Candida albicans locus: CaO19.5970
5114 CaO19.3252 CAL0003338 Predicted zinc-finger protein of unknown function; has similarity to S. cerevisiae Dal81p, which is a transcription factor involved in the regulation of nitrogen-degradation genes YIR023W DAL81 Positive regulator of genes in multiple nitrogen degradation pathways; contains DNA binding domain but does not appear to bind the dodecanucleotide sequence present in the promoter region of many genes involved in allantoin catabolism CaO19.3252 DAL81 hypothetical protein Positive regulator for allantoin and GABA catabolic genes; potential fungal Zn(2)-Cys(6) binuclear cluster domain AAGTTGGCTAAACCGTTACAGTTGCAACTTCGAAACTGGTTTTATTCATTGCCGAGCGAGTTGCAAAT Ortholog of Candida albicans locus: CaO19.3252
5115 CaO19.2406 CAL0001455 Predicted ORF from Assembly 19 YGR163W GTR2 Cytoplasmic GTP binding protein, negative regulator of the Ran/Tc4 GTPase cycle downstream of Gtr1p; homolog of human RagC and RagD proteins; component of the EGO complex, which is involved in the regulation of microautophagy CaO19.2406 GTR2 hypothetical protein Putative small GTPase ACTACTTTGAGCCAAATTATGATTCAGAAAGGTTATTTTCATCTGTTGGGGCTTTAGTATATGTAATT Ortholog of Candida albicans locus: CaO19.2406
5116 CaO19.2629 CAL0003416 Predicted ORF from Assembly 19 YLR309C IMH1 Protein involved in vesicular transport, mediates transport between an endosomal compartment and the Golgi, contains a Golgi-localization (GRIP) domain that interacts with activated Arl1p-GTP to localize Imh1p to the Golgi CaO19.2629 USO1 likely vesicular transport factor Uso1p similar to S. cerevisiae USO1 (YDL058W) general vesicular transport factor/vesicle docking protein CATAAAGAACAATTTAGCAACAAGCAATCAGAAGAATATCTTTCGAAAAGAATACTGACATTGAAAAG Ortholog of Candida albicans locus: CaO19.2629
5117 CaO19.2917 CAL0005973 Predicted ORF from Assembly 19 YER006W NUG1 GTPase that associates with nuclear 60S pre-ribosomes, required for export of 60S ribosomal subunits from the nucleus CaO19.2917 hypothetical protein similar to S. cerevisiae NUG1 nuclear GTPase involved in rRNA processing GACAATGACATGATTGACTCTGATGAGGATGTGGAGATCGAGTTGAGTGAAGTTGAAGATGATGAAGA Ortholog of Candida albicans locus: CaO19.2917
5118 CaO19.4979 CAL0006406 Protein not essential for viability; similar to S. cerevisiae Kns1p, which is a protein kinase YLL019C KNS1 Nonessential putative protein kinase of unknown cellular role; member of the LAMMER family of protein kinases, which are serine/threonine kinases also capable of phosphorylating tyrosine residues CaO19.4979 KNS1 likely protein kinase Serine/threonine protein kinase TCACTGATTTGTTGAAGATTTCATTATATGATTTCTTGGAGAATAATAAATTCATTTCATTCCCTGGA Ortholog of Candida albicans locus: CaO19.4979
5119 CaO19.3651 CAL0000415 Phosphoglycerate kinase; enzyme of glycolysis; localizes to cell wall and to cytoplasm; antigenic during murine or human systemic infection; biofilm, Hog1p, GCN-induced; downregulated upon phagocytosis; possible N-glycosylation at N349 YCR012W PGK1 3-phosphoglycerate kinase, catalyzes transfer of high-energy phosphoryl groups from the acyl phosphate of 1,3-bisphosphoglycerate to ADP to produce ATP; key enzyme in glycolysis and gluconeogenesis CaO19.3651 PGK1 hypothetical protein 3-phosphoglycerate kinase similar to S. cerevisiae PGK1 (YCR012W); gluconeogenesis ATTCAGAGATCAATTGTCATCATTGGCTGATGTTTACGTTAACGATGCTTTCGGAACTGCTCACAGAG Ortholog of Candida albicans locus: CaO19.3651
5120 CaO19.7100 CAL0002799 Predicted ORF from Assembly 19 YJR001W AVT1 Vacuolar transporter, imports large neutral amino acids into the vacuole; member of a family of seven S. cerevisiae genes (AVT1-7) related to vesicular GABA-glycine transporters CaO19.7100 AVT11 hypothetical protein similar to transmembrane amino acid transporter that controls vacuolar uptake of large neutral amino acids TAGCTCATTCACTCGTGCACAATCTTTTGCAGCTTCCAAAATCGACAATGAGATCCACAAAGAAAGAT Ortholog of Candida albicans locus: CaO19.7100

Total number of rows: 3851

Table truncated, full table size 1762 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap