NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4623 Query DataSets for GPL4623
Status Public on Jun 04, 2007
Title ISU-Maize-Oligo1.1
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Zea mays
Manufacturer Schnable Laboratory at Iowa State University(ISU)
Manufacture protocol 70-mer oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA), resuspended at 50 uM in 3X SSC and spotted on Corning (Lowell, MA, USA) UltraGaps slides. Together, the sense and corresponding antisense oligos are termed S/A pairs and were spotted in adjacent positions on the oligoarray. Each S/A pair was spotted in duplicate on the array, flipping the physical location of each member of the S/A pair. In total, 7,419 unique S/A pairs were printed in duplicate on the microarray representing 4,765 non-redundant pairs of both strand-specific transcripts since some genes have more than one oligo pairs.
 
 
Contributor(s) Schnable PS
Submission date Dec 04, 2006
Last update date Sep 07, 2007
Contact name Patrick S. Schnable
E-mail(s) schnable@iastate.edu
Phone 515-294-0975
Organization name Iowa State University
Street address 2035B Roy J Carver Co-Lab
City Ames
State/province IA
ZIP/Postal code 50011
Country USA
 
Samples (10) GSM183468, GSM183469, GSM183602, GSM183603, GSM183604, GSM183625 
Series (1)
GSE7608 Natural antisense transcripts accumulate for over 70% of maize genes and exhibit genotypic-specific expression patterns

Data table header descriptions
ID
Field Name of a field where the spot is located. In this chip there were two fields named Up and Down, they described the upper and lower part(location) of the chip
Meta_Row The number of rows of subgrids
Meta_Column The number of columns of subgrids
Row The number of rows of spots contained within the grid
Column The number of columns of spots contained within the grid
GB_ACC_List GenBank Accession Number of spot or list of GenBank Accession Numbers if a spot is associated with one or two numbers
GB_LIST GenBank Accession Number(s)
Other_Source_Sequence Genomic contigs and est contigs sequences for oligo design
ref oligo source refer information of spots
Design_Category Oligo design strategies
strand Oligo orientation plus/minus
SEQUENCE Oligo sequence
spotinfo Specifies spot category
SPOT_ID spot identifier

Data table
ID Field Meta_Row Meta_Column Row Column GB_ACC_List GB_LIST Other_Source_Sequence ref Design_Category strand SEQUENCE spotinfo SPOT_ID
1 up 1 1 1 1 BM378433.1 BM378433.1 B73_MEC_1009 B73Mo17.1.1.P EST-EST P cagaacacaaattctgtctcccagctcacggacagataaatttctggttttagctcagtgaattcaggcc putative antisense
2 up 1 1 1 2 BM378433.1 BM378433.1 B73_MEC_1009 B73Mo17.1.1.M EST-EST M ggcctgaattcactgagctaaaaccagaaatttatctgtccgtgagctgggagacagaatttgtgttctg putative antisense
3 up 1 1 1 3 BM378433.1 BM378433.1 B73_MEC_1009 B73Mo17.2.1.P EST-EST P agtgacattcgcactacatatccatgaacaagtttgctacacaacacagatactgcctcccagctcacgg putative antisense
4 up 1 1 1 4 BM378433.1 BM378433.1 B73_MEC_1009 B73Mo17.2.1.M EST-EST M ccgtgagctgggaggcagtatctgtgttgtgtagcaaacttgttcatggatatgtagtgcgaatgtcact putative antisense
5 up 1 1 1 5 BM378615.1 BM378615.1 B73_MEC_107 B73Mo17.4.1.P EST-EST P ttgctccagtccttgatcttctcagcaattgcttttgtttgtgcagcaacaacatccatggtagacccag putative antisense
6 up 1 1 1 6 BM378615.1 BM378615.1 B73_MEC_107 B73Mo17.4.1.M EST-EST M ctgggtctaccatggatgttgttgctgcacaaacaaaagcaattgctgagaagatcaaggactggagcaa putative antisense
7 up 1 1 1 7 BM378903.1 BM378903.1 B73_MEC_2308 B73Mo17.5.1.P EST-EST P tatgctgcccaagtctcagttttttacagaagaacacaagaagatgtagatcctctaaccatccagcggt putative antisense
8 up 1 1 1 8 BM378903.1 BM378903.1 B73_MEC_2308 B73Mo17.5.1.M EST-EST M accgctggatggttagaggatctacatcttcttgtgttcttctgtaaaaaactgagacttgggcagcata putative antisense
9 up 1 1 1 9 BM378903.1 BM378903.1 B73_MEC_1109 B73Mo17.6.1.P EST-EST P accagcagcttgtctttcagggtgaataactcaaggataaatctttgtacagaatcagtaaacgagccgg putative antisense
10 up 1 1 1 10 BM378903.1 BM378903.1 B73_MEC_1109 B73Mo17.6.1.M EST-EST M ccggctcgtttactgattctgtacaaagatttatccttgagttattcaccctgaaagacaagctgctggt putative antisense
11 up 1 1 1 11 BM379055.1 BM379055.1 Mo17_MEC_58 B73Mo17.7.1.P EST-EST P gccaattgctctagctctcaggaacgaaccaggaacaacaggctcctgcatcaggaccaacacatccatt putative antisense
12 up 1 1 1 12 BM379055.1 BM379055.1 Mo17_MEC_58 B73Mo17.7.1.M EST-EST M aatggatgtgttggtcctgatgcaggagcctgttgttcctggttcgttcctgagagctagagcaattggc putative antisense
13 up 1 1 1 13 BM378462.1 BM378462.1 B73_MEC_2167 B73Mo17.54.2.P EST-EST P tgaagtaaactgtgagtacgaagtcaatccctggaaccagaaaatgcaaaagagatctacgtgcacgaag putative antisense
14 up 1 1 1 14 BM378462.1 BM378462.1 B73_MEC_2167 B73Mo17.54.2.M EST-EST M cttcgtgcacgtagatctcttttgcattttctggttccagggattgacttcgtactcacagtttacttca putative antisense
15 up 1 1 1 15 BM378906.1 BM378906.1 B73_MEC_226 B73Mo17.55.2.P EST-EST P tcctcctggagctgcttcaccttggtgatgtaatcattcatcgcctcatccttcgatttgccttcaacag putative antisense
16 up 1 1 1 16 BM378906.1 BM378906.1 B73_MEC_226 B73Mo17.55.2.M EST-EST M ctgttgaaggcaaatcgaaggatgaggcgatgaatgattacatcaccaaggtgaagcagctccaggagga putative antisense
17 up 1 1 1 17 BM378906.1 BM378906.1 B73_MEC_226 B73Mo17.56.2.P EST-EST P atagatggatatcatcattatggccctttattttccctctactttaatatatgggtgcgcagtcctcctg putative antisense
18 up 1 1 1 18 BM378906.1 BM378906.1 B73_MEC_226 B73Mo17.56.2.M EST-EST M caggaggactgcgcacccatatattaaagtagagggaaaataaagggccataatgatgatatccatctat putative antisense
19 up 1 1 1 19 BM379042.1 BM379042.1 B73_MEC_2278 B73Mo17.57.2.P EST-EST P caagctcaaggcatcgattaatcgtacagaggtggcggcgcgccactgccttctacttcttgccacctgc putative antisense
20 up 1 1 1 20 BM379042.1 BM379042.1 B73_MEC_2278 B73Mo17.57.2.M EST-EST M gcaggtggcaagaagtagaaggcagtggcgcgccgccacctctgtacgattaatcgatgccttgagcttg putative antisense

Total number of rows: 30368

Table truncated, full table size 5279 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap