 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 23, 2007 |
| Title |
Bacillus subtilis 168 4K Oligo Array |
| Technology type |
spotted oligonucleotide |
| Distribution |
non-commercial |
| Organism |
Bacillus subtilis |
| Manufacturer |
University of Groningen |
| Manufacture protocol |
Oligo spotted on ArrayIt Superamine slides in duplicates
|
| Support |
glass |
| Coating |
aminosilane |
| |
|
| Description |
12pins spotting with Telechem 946MP3 pins
spotsize 90-100 um
|
| |
|
| Submission date |
Oct 22, 2007 |
| Last update date |
Jan 25, 2011 |
| Contact name |
Jan-Willem Veening |
| E-mail(s) |
j.w.veening@rug.nl
|
| Organization name |
University of Groningen
|
| Street address |
Nijenborgh 7
|
| City |
Groningen |
| ZIP/Postal code |
9747 AG |
| Country |
Netherlands |
| |
|
| Samples (173)
|
GSM235080, GSM495251, GSM495252, GSM495253, GSM495254, GSM495255
GSM495256, GSM495257, GSM495258, GSM495259, GSM495260, GSM495261, GSM495262, GSM495263, GSM495264, GSM495265, GSM495266, GSM495267, GSM495268, GSM495269, GSM495270, GSM495271, GSM495272, GSM495273, GSM495274, GSM495275, GSM495276, GSM495277, GSM495278, GSM495279, GSM495280, GSM495281, GSM495282, GSM495283, GSM495284, GSM495285, GSM495286, GSM495287, GSM495288, GSM495289, GSM495290, GSM495291, GSM495292, GSM495293, GSM495294, GSM495295, GSM495296, GSM495297, GSM495298, GSM495299, GSM495300, GSM495301, GSM495302, GSM495303, GSM495304, GSM495305, GSM495306, GSM495307, GSM495308, GSM495309, GSM495310, GSM495311, GSM495312, GSM495313, GSM495314, GSM495315, GSM495316, GSM495317, GSM495318, GSM495319, GSM495320, GSM495321, GSM495322, GSM495323, GSM495324, GSM495325, GSM495326, GSM495327, GSM495328, GSM495329, GSM495330, GSM495331, GSM495332, GSM495333, GSM495334, GSM495335, GSM495336, GSM495337, GSM495338, GSM495339, GSM495340, GSM495341, GSM495342, GSM495343, GSM495344, GSM495345, GSM495346, GSM495347, GSM495348, GSM495349, GSM495350, GSM495351, GSM495352, GSM495353, GSM495354, GSM495355, GSM495356, GSM495357, GSM495358, GSM495359, GSM495360, GSM495361, GSM495362, GSM495363, GSM495364, GSM495365, GSM495366, GSM495367, GSM495368, GSM556608, GSM556609, GSM556610, GSM556611, GSM556612, GSM556613, GSM556614, GSM556615, GSM848762, GSM848763, GSM848764, GSM904720, GSM904721, GSM904722, GSM904723, GSM956794, GSM956795, GSM956796, GSM956797, GSM956798, GSM956799, GSM956800, GSM956801, GSM1011025, GSM1011026, GSM1011027, GSM1011028, GSM1011029, GSM1011030, GSM1011031, GSM1011032, GSM1071997, GSM1071998, GSM1071999, GSM1072000, GSM1072001, GSM1072002, GSM1072003, GSM1162398, GSM1162399, GSM1162400, GSM1162401, GSM1162402, GSM1162403, GSM1162404, GSM1162405, GSM1162406, GSM1499948, GSM1499949, GSM1499950, GSM1499951, GSM1499952, GSM1499953, GSM1499954
|
| Series (9)
|
| GSE9266 |
Subpopulation array data, Veening et al. |
| GSE19831 |
Growing pains: natural stress response during growth of B. subtilis (high density time-resolved transcriptome analysis) |
| GSE22370 |
Role of Rok in biofilm structure development of Bacillus subtilis 168 |
| GSE34414 |
Identification of the genes regulated by YvfI transcriptional factor |
| GSE36877 |
Comparison of Bacillus subtilis wild type and cshA mutant at exponential versus stationary phase |
| GSE39142 |
The YmdB phosphodiesterase is a global regulator of biofilm-specific mRNA levels in Bacillus subtilis |
| GSE43840 |
Sliding of Bacillus subtilis Natto |
| GSE47918 |
Effect of floT and floA mutations on the global transcriptome of Bacillus subtilis NCIB3610 |
| GSE61232 |
The impact of manganese on biofilm development of Bacillus subtilis. |
|
| Data table header descriptions |
| ID |
|
| GI_PROTEIN |
GenBank identifier |
| ORF |
locus tag |
| SEQUENCE |
sequence of oligo |
| GENE |
open reading frame designator |
| GENOME_ACC |
Genome accession number |
| ORGANISM |
The organism source of the spots |
| GR |
Grid Row of spot |
| GC |
Grid Column of spot |
| SC |
Spot Column of spot |
| SPOT_ID |
spot identifier |
| Data table |
| ID |
GI_PROTEIN |
ORF |
SEQUENCE |
GENE |
GENOME_ACC |
ORGANISM |
GR |
GC |
SC |
SPOT_ID |
| BSU00010 |
16077069 |
BSU00010 |
GAGTTTGGAGGACGTGATCATACGACCGTTATTCATGCGCATGAAAAAATTTCAAAACTGCTGGCAGATG |
dnaA |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
3 |
3 |
18 |
|
| BSU00020 |
16077070 |
BSU00020 |
CCGCAAAACCGGCTGAATCCATTGAAATTTCTTCCAATTCGCCAGAAATCGGTAAAGTTGTGGAAGCAAT |
dnaN |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
1 |
2 |
18 |
|
| BSU00030 |
16077071 |
BSU00030 |
CGCCGGGGCAGAAAGCTGTATGTTGGAGATGTGGTAGAGATTGAAGGATTTGGTTCATTTCAAGTCGTCA |
yaaA |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
2 |
2 |
18 |
|
| BSU00040 |
16077072 |
BSU00040 |
TGGCATTGATCACGAAACCTTACGTCAAGCAGGAATGTTCCGTGTGCAAAATGGTGCGTTAGTGAAGTGA |
recF |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
3 |
2 |
18 |
|
| BSU00050 |
16077073 |
BSU00050 |
GTGATGACTTTGTGGTTTCAACACGAGATATTGTCGGCATTTTTGACTTTAAAGCCAACATGTCGCCT |
yaaB |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
1 |
2 |
18 |
|
| BSU00060 |
16077074 |
BSU00060 |
AGGTAACTCTTGAAGATGCAATGGATGCGGATGAGACTTTTGAAATGCTTATGGGCGACAAGGTAGAACC |
gyrB |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
2 |
2 |
18 |
|
| BSU00070 |
16077075 |
BSU00070 |
GGACATCAATGATATCTCCATCACCGGACGTGTCACTCAAGGTGTGCGTCTCATCAGAATGGCAGAAGAA |
gyrA |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
3 |
2 |
18 |
|
| BSU00080 |
16077076 |
BSU00080 |
CTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGTCGGTGAGGTAACCTTTTAGGAG |
yaaC |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
1 |
2 |
18 |
|
| BSU00090 |
16077077 |
BSU00090 |
GTATGGGGTATTGCGGGTCCAAAGATCTGCGTGCGCTAAGAGAAGAAGCTCAGTTCATTCGCATGACTGG |
guaB |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
2 |
2 |
18 |
|
| BSU00100 |
16077078 |
BSU00100 |
GTCACACTGAATAAAGACAACTTAACTGCTCCTGTGAAAAAAGGAACCAAGGTTGGGAAGCTGACTGCGG |
dacA |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
3 |
2 |
18 |
|
| BSU00110 |
16077079 |
BSU00110 |
TACTGCAATGAAAGGGATTGAAATCTCAAACTTACTTCCAGAACAGCGTATGCAAGAACGCGGCTGGTAA |
yaaD |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
1 |
2 |
18 |
|
| BSU00120 |
16077080 |
BSU00120 |
CGGAGCTGACAGAAGATCACCGAGTGACGCAGCTGTTTGTTGAAATGGTTGAGGAATATAAGCAAAAGGC |
yaaE |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
2 |
2 |
18 |
|
| BSU00130 |
16077081 |
BSU00130 |
AATCTCTTCTTGCAGCAACTTCGAAGCGTTCCAGGCGAGACGTGCGAATATTCGTTTCAGACGTGAAGCG |
serS |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
3 |
2 |
18 |
|
| BSU00140 |
16077082 |
BSU00140 |
GGAGGAATACCCAAGTCCGGCTGAAGGGATCGGTCTTGAAAACCGACAGGGGTGTCAAAGCCCGCGGGG |
dck |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
1 |
2 |
18 |
|
| BSU00150 |
16077083 |
BSU00150 |
GATTCAAAGGATTTCGTTTTGAATAAGAGCGACTTTGAACGCATTGCCGCCCATGTAAAGGAGCTTATCG |
dgk |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
2 |
2 |
18 |
|
| BSU00160 |
16077084 |
BSU00160 |
GAATCAAATGCTTATTTGGAGCCCCGAGGAAATCAAGTCAGCGAAAATCTCCAGCAGGCGGCCAGAGAAG |
yaaH |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
3 |
2 |
18 |
|
| BSU00170 |
16077085 |
BSU00170 |
CCGCTAATGACGCTTATATGAGGGAATACAGCATCACGATTCCTAAGGACTGTATCGCGTCAAACAGTGA |
yaaI |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
1 |
2 |
18 |
|
| BSU00180 |
16077086 |
BSU00180 |
GGCGGAATGCTCAGTGCGTTTTTCAGAGAACTAAGAAAAAAGAAGAAAGCCGCCAGGAAAAACTTGTCTG |
yaaJ |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
2 |
2 |
18 |
|
| BSU00190 |
16077087 |
BSU00190 |
GCCTTAAGTAAGTGGTGTTGACGTTTGGGTCCTGCGCAATGGGAATTCATGAACCATGTCAGGTCCGGAA |
dnaX |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
3 |
2 |
18 |
|
| BSU00200 |
16077088 |
BSU00200 |
GGCGGCGGTATGGTAACAGTAAAAGCAAACGGCCAAAAAGAAATCCTGGATGTTATCATCAAAGAAGAAG |
yaaK |
NC_000964 |
Bacillus subtilis subsp. subtilis str. 168 |
1 |
2 |
18 |
|
Total number of rows: 4167
Table truncated, full table size 661 Kbytes.
| Supplementary file |
Size |
Download |
File type/resource |
| GPL6031_full_array.txt.gz |
195.5 Kb |
(ftp)(http) |
TXT |
|
|
|
|
 |
Less...
More...