NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6516 Query DataSets for GPL6516
Status Public on Aug 21, 2008
Title US EPA Ecoarray FHM Pimephales promelas 10K 2000 gene (pilot) array
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Pimephales promelas
Manufacturer Agilent, Palo Alto, CA, USA
Manufacture protocol Briefly, probes for each gene were designed using Agilent’s probe design software. Each of the 60-mer probes was synthesized in situ on 1” x 3” (24.2 mm x 76.2 mm) treated glass slides using SurePrint inkjet deposition technology (http://www.chem.agilent.com). All probes were synthesized in duplicate at random locations on the slide surface. Since we could not confirm the direction of genes with an E-value greater than 1E-5, probes were designed and synthesized from both strands (forward and reverse complement) for the sequences. To facilitate evaluations of the microarray (described below), multiple probes that spanned the vitellogenin (vtg) 1 genes were also synthesized on the chips. Probe sequences for each of the genes are available (under license agreement) from EcoArray. Probes for specific genes on the microarrays were assigned a unique Probe Identification number, similar in concept to Accession numbers that are assigned to sequences in National Center for Biotechnology Information databases. This number (EA_Pp_###) allows for the cross-referencing of sequences from one experiment.
Catalog number CH-FHM-2000
Support glass
Coating unknown
 
 
Web link http://www.ecoarray.com
Contributor(s) Villeneuve DL, Knoebl I, Larkin P, Miracle AL, Carter BJ, Denslow ND, Ankley GT
Submission date Feb 21, 2008
Last update date Aug 21, 2008
Contact name Daniel L. Villeneuve
E-mail(s) villeneuve.dan@epa.gov
Organization name US EPA
Department Mid-Continent Ecology Division
Lab National Health and Environmental Effects Research Laboratory
Street address 6201 Congdon Blvd
City Duluth
State/province MN
ZIP/Postal code 55804
Country USA
 
Samples (32) GSM267277, GSM267278, GSM267465, GSM267466, GSM267467, GSM267468 
Series (2)
GSE10722 Altered gene expression in the brain and liver of female fathead minnows exposed to fadrozole
GSE14235 Gene expression signatures for 17α-ethinylestradiol and ZM 189,154, singly and combined, in fathead minnow testis

Data table header descriptions
ID
Ecoarray ID Probe id assigned by Ecoarray Inc. (ID revised to account for duplicate probes on the array)
Target Sequence Name Unique identifier for the sequence in Ecoarray's database
Query Name Unique identifier for sequence used for BLAST
Gene Name (NR…nt)
Biological_Process Biological Process GO annotation
Cellular Component Cellular component GO annotation
Molecular Function Molecular function GO annotation
NR Hit Acc# Top hit in the non-redundant database (NCBI)
NR E-value E-value for top hit in the non-redundant database (NCBI)
NR Hit Def Description provided for top hit in the non-redundant database (NCBI)
NT Hit Acc# Top hit in the nucleotide database (NCBI)
NT E-value E-value for top hit in the nucleotide database (NCBI)
NT Hit Def Description provided for top hit in the nucleotide database (NCBI)
SEQUENCE Nucleotide sequence of probe
SPOT_ID

Data table
ID Ecoarray ID Target Sequence Name Query Name Gene Name (NR…nt) Biological_Process Cellular Component Molecular Function NR Hit Acc# NR E-value NR Hit Def NT Hit Acc# NT E-value NT Hit Def SEQUENCE SPOT_ID
EA_Pp_10001 EA_Pp_10001 EPA_18S_100 EPA_18S PREDICTED: similar to rRNA intron-encoded homing endonuclease [Pan troglodytes] 0 0 0 XP_525925 5.61E-21 PREDICTED: similar to rRNA intron-encoded homing endonuclease [Pan troglodytes] BX537263 0 Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14, complete sequence AGGGACAAGTGGCGTTCAGCCACGCGAGATGGAGCAATAACAGGTCCTGTGATGCCCTTA EA_Pp_10001
EA_Pp_10002 EA_Pp_10002 EPA_18S_100 EPA_18S PREDICTED: similar to rRNA intron-encoded homing endonuclease [Pan troglodytes] 0 0 0 XP_525925 5.61E-21 PREDICTED: similar to rRNA intron-encoded homing endonuclease [Pan troglodytes] BX537263 0 Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14, complete sequence GATTTGTCTGGTTCATTCCGATAACGAACGAGACTCCGGCATGCTAACTAGTTACGCGGC EA_Pp_10002
EA_Pp_10003 EA_Pp_10003 EPA_18S_100_another EPA_18S PREDICTED: similar to rRNA intron-encoded homing endonuclease [Pan troglodytes] 0 0 0 XP_525925 5.61E-21 PREDICTED: similar to rRNA intron-encoded homing endonuclease [Pan troglodytes] BX537263 0 Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14, complete sequence ATCGCGGGTCGGCATCGTTTACGGTCGGAACTACGACGGTATCTGATCGTCTTCGAACCT EA_Pp_10003
EA_Pp_10004 EA_Pp_10004 EPA_18S_100_another EPA_18S PREDICTED: similar to rRNA intron-encoded homing endonuclease [Pan troglodytes] 0 0 0 XP_525925 5.61E-21 PREDICTED: similar to rRNA intron-encoded homing endonuclease [Pan troglodytes] BX537263 0 Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14, complete sequence TTCCGTCAATTCCTTTAAGTTTCAGCTTTGCAACCATACTCCCCCCGGAACCCAAAGACT EA_Pp_10004
EA_Pp_10005 EA_Pp_10005 EPA_28S_100 EPA_28S putative senescence-associated protein [Pisum sativum] 0 0 0 BAB33421 3.64E-27 putative senescence-associated protein [Pisum sativum] BX537263 0 Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14, complete sequence GTGAGACAGGTTAGTTTTACCCTACTGATGTCCGTGTCGTTGCAATAGTAATCCTGCTCA EA_Pp_10005
EA_Pp_10006 EA_Pp_10006 EPA_28S_100 EPA_28S putative senescence-associated protein [Pisum sativum] 0 0 0 BAB33421 3.64E-27 putative senescence-associated protein [Pisum sativum] BX537263 0 Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14, complete sequence CTCAGTACGAGAGGAACCGCAGGTTCAGACATTTGGTGCGTGTGCTTCGCGGCCTCATAT EA_Pp_10006
EA_Pp_10007 EA_Pp_10007 EPA_28S_100, EPA_28S putative senescence-associated protein [Pisum sativum] 0 0 0 BAB33421 3.64E-27 putative senescence-associated protein [Pisum sativum] BX537263 0 Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14, complete sequence GGAAGAGCCGACATCGAAGGATCAAAAAGCGACGTCGCTATGAACGCTTAGCCGCCTCAT EA_Pp_10007
EA_Pp_10008 EA_Pp_10008 EPA_28S_100, EPA_28S putative senescence-associated protein [Pisum sativum] 0 0 0 BAB33421 3.64E-27 putative senescence-associated protein [Pisum sativum] BX537263 0 Zebrafish DNA sequence from clone DKEY-208G1 in linkage group 14, complete sequence GACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTGAA EA_Pp_10008
EA_Pp_10009 EA_Pp_10009 EPA_40S_ribosomal_protein_S2_1 EPA_40S_ribosomal_protein_S2 40S ribosomal protein S2 GO:0006412; protein biosynthesis GO:0005840; ribosome GO:0015935; small ribosomal subunit GO:0005622; intracellular GO:0030529; ribonucleoprotein complex GO:0003735; structural constituent of ribosome AAK95183 0 40S ribosomal protein S2 [Ictalurus punctatus] >gi|22001963|sp|Q90YS3|RS2_ICTPU 40S ribosomal protein S2 BC067645 0 Danio rerio zgc:85824, mRNA (cDNA clone MGC:85824 IMAGE:6962406), complete cds AGTCTGAGATCATTGACTTCTTCCTGGGCTCAGCACTGAAAGATGAAGTTCTGAAGATCA EA_Pp_10009
EA_Pp_10010 EA_Pp_10010 EPA_40S_ribosomal_protein_S2_1 EPA_40S_ribosomal_protein_S2 40S ribosomal protein S2 GO:0006412; protein biosynthesis GO:0005840; ribosome GO:0015935; small ribosomal subunit GO:0005622; intracellular GO:0030529; ribonucleoprotein complex GO:0003735; structural constituent of ribosome AAK95183 0 40S ribosomal protein S2 [Ictalurus punctatus] >gi|22001963|sp|Q90YS3|RS2_ICTPU 40S ribosomal protein S2 BC067645 0 Danio rerio zgc:85824, mRNA (cDNA clone MGC:85824 IMAGE:6962406), complete cds AATCGAGGATAAAGAGTGGGTTCCTGTGACCAAACTTGGTCGTCTGGTGAAGGATATGAA EA_Pp_10010
EA_Pp_10011 EA_Pp_10011 EPA_60S_ribosomal_protein_L29_1 EPA_60S_ribosomal_protein_L29 PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin binding protein HIP) [Canis familiaris] GO:0006412; protein biosynthesis GO:0005840; ribosome GO:0005622; intracellular GO:0003735; structural constituent of ribosome XP_536681 3.87E-06 PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin binding protein HIP) [Canis familiaris] NM_001003434 1.22E-11 Danio rerio zgc:92868 (zgc:92868), mRNA CCAGAGAGTCAGCGGTGTACAGATGTTCTCCAGAAGGACTTGATGCCATGCTCAATAAAG EA_Pp_10011
EA_Pp_10012 EA_Pp_10012 EPA_60S_ribosomal_protein_L29_1 EPA_60S_ribosomal_protein_L29 PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin binding protein HIP) [Canis familiaris] GO:0006412; protein biosynthesis GO:0005840; ribosome GO:0005622; intracellular GO:0003735; structural constituent of ribosome XP_536681 3.87E-06 PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin binding protein HIP) [Canis familiaris] NM_001003434 1.22E-11 Danio rerio zgc:92868 (zgc:92868), mRNA ATCGCCAAGAAAGCGGCGTCCAAATAGATGAGGACAGACCCCAGAGAGTCAGCGGTGTAC EA_Pp_10012
EA_Pp_10013 EA_Pp_10013 EPA_60S_ribosomal_protein_L29_1_another EPA_60S_ribosomal_protein_L29 PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin binding protein HIP) [Canis familiaris] GO:0006412; protein biosynthesis GO:0005840; ribosome GO:0005622; intracellular GO:0003735; structural constituent of ribosome XP_536681 3.87E-06 PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin binding protein HIP) [Canis familiaris] NM_001003434 1.22E-11 Danio rerio zgc:92868 (zgc:92868), mRNA GGCTTCTTGATGCCGTTCCTGTGCGACTTCCGAGACTGGTTGTGCGAGGTGTGGTTTCTT EA_Pp_10013
EA_Pp_10014 EA_Pp_10014 EPA_60S_ribosomal_protein_L29_1_another EPA_60S_ribosomal_protein_L29 PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin binding protein HIP) [Canis familiaris] GO:0006412; protein biosynthesis GO:0005840; ribosome GO:0005622; intracellular GO:0003735; structural constituent of ribosome XP_536681 3.87E-06 PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin binding protein HIP) [Canis familiaris] NM_001003434 1.22E-11 Danio rerio zgc:92868 (zgc:92868), mRNA GTACCTACCACTCTTTCAGAGAGCTCGTAGCGACTGAGTACCTGGGCTTCTTGATGCCGT EA_Pp_10014
EA_Pp_10015 EA_Pp_10015 EPA_adenosine_deaminase_1 EPA_adenosine_deaminase adenosine deaminase, RNA-specific, B1 GO:0006396; RNA processing GO:0005622; intracellular GO:0003725; double-stranded RNA binding GO:0004000; adenosine deaminase activity GO:0003723; RNA binding NP_571685 0 adenosine deaminase, RNA-specific, B1 [Danio rerio] >gi|15593021|gb|AAL02181.1| adenosine deaminase [Danio rerio] >gi|15593015|gb|AAL02179.1| adenosine deaminase [Danio rerio] AF403113 0 Danio rerio adenosine deaminase mRNA, complete cds, alternatively spliced AACATGGCTACCGGCTAAAAAACGATATTCAGTTCCATCTGTATATCAGCACGTCGCCCT EA_Pp_10015
EA_Pp_10016 EA_Pp_10016 EPA_adenosine_deaminase_1 EPA_adenosine_deaminase adenosine deaminase, RNA-specific, B1 GO:0006396; RNA processing GO:0005622; intracellular GO:0003725; double-stranded RNA binding GO:0004000; adenosine deaminase activity GO:0003723; RNA binding NP_571685 0 adenosine deaminase, RNA-specific, B1 [Danio rerio] >gi|15593021|gb|AAL02181.1| adenosine deaminase [Danio rerio] >gi|15593015|gb|AAL02179.1| adenosine deaminase [Danio rerio] AF403113 0 Danio rerio adenosine deaminase mRNA, complete cds, alternatively spliced TCAGCGACAGCACTGAAGAACATGAGAAATCCATATTCAGATGGTGCAGTGAACATGGCT EA_Pp_10016
EA_Pp_10017 EA_Pp_10017 EPA_alcohol_dehydrogenase_3_1 EPA_alcohol_dehydrogenase_3 Alcohol dehydrogenase 5 0 0 GO:0016491; oxidoreductase activity GO:0046872; metal ion binding GO:0008270; zinc ion binding AAH67170 0 Alcohol dehydrogenase 5 [Danio rerio] >gi|46195771|ref|NP_571924.2| alcohol dehydrogenase 5 [Danio rerio] BC067170 0 Danio rerio alcohol dehydrogenase 5, mRNA (cDNA clone MGC:77553 IMAGE:6960016), complete cds TGAGTTTGTTACTCACACATTGCCCTTTACCCAGATCAATGAGGCCTTTGACCTGATGCA EA_Pp_10017
EA_Pp_10018 EA_Pp_10018 EPA_alcohol_dehydrogenase_3_1 EPA_alcohol_dehydrogenase_3 Alcohol dehydrogenase 5 0 0 GO:0016491; oxidoreductase activity GO:0046872; metal ion binding GO:0008270; zinc ion binding AAH67170 0 Alcohol dehydrogenase 5 [Danio rerio] >gi|46195771|ref|NP_571924.2| alcohol dehydrogenase 5 [Danio rerio] BC067170 0 Danio rerio alcohol dehydrogenase 5, mRNA (cDNA clone MGC:77553 IMAGE:6960016), complete cds GAGTGTGGAGAGTGTTCCTAAGCTGGTTAATGACTACATGAGTAAGAAGCTGATGGTGGA EA_Pp_10018
EA_Pp_10019 EA_Pp_10019 EPA_alpha_2_plasmin_inhibitor_1 EPA_alpha_2_plasmin_inhibitor PREDICTED: similar to Alpha-2-antiplasmin precursor (Alpha-2-plasmin inhibitor) (Alpha-2-PI) (Alpha-2-AP) [Danio rerio] GO:0006355; regulation of transcription, DNA-dependent GO:0005634; nucleus GO:0003700; transcription factor activity GO:0004867; serine-type endopeptidase inhibitor activity GO:0003824; catalytic activity XP_692114 8.82E-35 PREDICTED: similar to Alpha-2-antiplasmin precursor (Alpha-2-plasmin inhibitor) (Alpha-2-PI) (Alpha-2-AP) [Danio rerio] AC099414 0.679814 0 GCCGCAACAAGTGTGGTCATCTCACGTTCCAATCCTACATTTACTGTCAATCAGCCATTT EA_Pp_10019
EA_Pp_10020 EA_Pp_10020 EPA_alpha_2_plasmin_inhibitor_1 EPA_alpha_2_plasmin_inhibitor PREDICTED: similar to Alpha-2-antiplasmin precursor (Alpha-2-plasmin inhibitor) (Alpha-2-PI) (Alpha-2-AP) [Danio rerio] GO:0006355; regulation of transcription, DNA-dependent GO:0005634; nucleus GO:0003700; transcription factor activity GO:0004867; serine-type endopeptidase inhibitor activity GO:0003824; catalytic activity XP_692114 8.82E-35 PREDICTED: similar to Alpha-2-antiplasmin precursor (Alpha-2-plasmin inhibitor) (Alpha-2-PI) (Alpha-2-AP) [Danio rerio] AC099414 0.679814 0 TGGATGACCTGAGCCAAACGCCATTTTTTCTGGGAGTAATTTCCAACCCAAACCCTGGAG EA_Pp_10020

Total number of rows: 10262

Table truncated, full table size 5517 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap