NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6741 Query DataSets for GPL6741
Status Public on Sep 30, 2008
Title University of Minnesota multi-species miRNA 480
Technology type spotted oligonucleotide
Distribution non-commercial
Organisms Caenorhabditis elegans; Drosophila melanogaster; Danio rerio; Homo sapiens; Mus musculus; Rattus norvegicus
Manufacturer Biomedical Genomics Center Microarray Facility at the University of Minnesota
Manufacture protocol A miRNA probe set was purchased from Invitrogen, which was designed based on the Sanger miRBase Sequence Database, Release 9.0. The set contains approximately 1,140 oligonucleotides of 34 to 44 nt long as probes. They are complementary to C. elegans, Drosophila, zebrafish, mouse, rat, and human miRNAs, and also include a number of internal and negative control probes. The oligonucleotides were dissolved in 3 x SSC and quadruply printed on CorningĀ® GAPSTM II coated slides using a BioRobotics Microgrid II spotter
 
 
Submission date Apr 14, 2008
Last update date Sep 30, 2008
Contact name Xiaoxiao Zhang
E-mail(s) zhang688@umn.edu
Organization name University of Minnesota
Street address 312 Church St. SE
City Minneapolis
ZIP/Postal code 55455
Country USA
 
Samples (18) GSM281674, GSM281675, GSM281676, GSM281677, GSM281678, GSM281679 
Series (1)
GSE11168 Ago2 stable cell line

Data table header descriptions
ID
miRNA_ID_LIST from Invitrogen
SEQUENCE
SPOT_ID

Data table
ID miRNA_ID_LIST SEQUENCE SPOT_ID
1 28S rRNA/dre-miR-739 28S rRNA/dre-miR-739
2 added for U6 added for U6
3 added snoRNA 5SN1 Homo sapiens added snoRNA 5SN1 Homo sapiens
4 added snoRNA ACA15 Homo sapiens added snoRNA ACA15 Homo sapiens
5 added snoRNA E1 Homo sapiens added snoRNA E1 Homo sapiens
6 added snoRNA E3 Homo sapiens added snoRNA E3 Homo sapiens
7 added snoRNA HBII-13 Homo sapiens added snoRNA HBII-13 Homo sapiens
8 added snoRNA HBII-436 Homo sapiens added snoRNA HBII-436 Homo sapiens
9 added snoRNA U46 Homo sapiens added snoRNA U46 Homo sapiens
10 added snoRNA U47 Homo sapiens added snoRNA U47 Homo sapiens
11 added snoRNA U49 Homo sapiens added snoRNA U49 Homo sapiens
12 added snoRNA U50 Homo sapiens added snoRNA U50 Homo sapiens
13 hsa-let-7a|cel-let-7|cbr-let-7|rno-let-7a|gga-let-7a|gga-let-7j|dre-let-7a|fru-let-7a|tni-let-7a|xtr-let-7a|bta-let-7a|mdo-let-7a AACTATACAACCTACTACCTCAAACTATACAACCTACTACCTCA
14 hsa-let-7b|mmu-let-7b|rno-let-7b|gga-let-7b|dre-let-7b|fru-let-7b|tni-let-7b|mdo-let-7b AACCACACAACCTACTACCTCAAACCACACAACCTACTACCTCA
15 hsa-let-7c|mmu-let-7c|rno-let-7c|gga-let-7c|dre-let-7c|ssc-let-7c|xtr-let-7c AACCATACAACCTACTACCTCAAACCATACAACCTACTACCTCA
16 hsa-let-7d|mmu-let-7d|rno-let-7d|mdo-let-7d ACTATGCAACCTACTACCTCTACTATGCAACCTACTACCTCT
17 hsa-let-7e|mmu-let-7e|rno-let-7e ACTATACAACCTCCTACCTCAACTATACAACCTCCTACCTCA
18 hsa-let-7f|rno-let-7f|gga-let-7f|dre-let-7f|ssc-let-7f|bta-let-7f|mdo-let-7f AACTATACAATCTACTACCTCAAACTATACAATCTACTACCTCA
19 hsa-let-7g|mmu-let-7g|gga-let-7g|mdo-let-7g ACTGTACAAACTACTACCTCAACTGTACAAACTACTACCTCA
20 hsa-let-7i|mmu-let-7i|rno-let-7i|gga-let-7i|xtr-let-7i|mdo-let-7i ACAGCACAAACTACTACCTCAACAGCACAAACTACTACCTCA

Total number of rows: 480

Table truncated, full table size 43 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap