NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7504 Query DataSets for GPL7504
Status Public on Oct 28, 2008
Title Agilent Axon scanner UNC custom 4X44K without Virus
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent
Manufacture protocol agilent printing protocol
 
 
Submission date Oct 20, 2008
Last update date Jul 17, 2015
Contact name Charles M. Perou
E-mail(s) cperou@med.unc.edu
Organization name University of North Carolina at Chapel Hill
Department Professor of Genetics, and Pathology & Laboratory Medicine; Lineberger Comprehensive Cancer Center
Street address 12-044 Lineberger Comprehensive Cancer Center CB# 7295
City Chapel Hill
State/province NC
ZIP/Postal code 27599-7264
Country USA
 
Samples (253) GSM455547, GSM455548, GSM455549, GSM455550, GSM455551, GSM455552 
Series (13)
GSE18229 Phenotypic and Molecular Characterization of the Claudin-low Intrinsic Subtype of Breast Cancer
GSE21997 Genomic predictors of response to doxorubicin versus docetaxel in breast cancer
GSE22049 MicroRNA-30c inhibits Human Breast Tumor Chemotherapy Resistance by regulating TWF1 and IL-11: Patient DataSet

Data table header descriptions
ID
NAME probe name at UNC microarray database
Gene ID
Refseq ID
Genebank Accession
Gene Symbol
Gene Description
Chromosome Number
Chromosome Map Location
SEQUENCE
Chromosome Coordinates
DCC Gene Symbol DCC Gene Symbol from TCGA project
ORF_LIST Entrez Gene Link
SPOT_ID

Data table
ID NAME Gene ID Refseq ID Genebank Accession Gene Symbol Gene Description Chromosome Number Chromosome Map Location SEQUENCE Chromosome Coordinates DCC Gene Symbol ORF_LIST SPOT_ID
1 GE_BRIGHTCORNER control
2 GE_BRIGHTCORNER control
3 DARKCORNER control
4 DARKCORNER control
5 DARKCORNER control
6 DARKCORNER control
7 DARKCORNER control
8 DARKCORNER control
9 DARKCORNER control
10 DARKCORNER control
11 DARKCORNER control
12 DARKCORNER control
13 DARKCORNER control
14 DARKCORNER control
15 DARKCORNER control
16 DARKCORNER control
17 DARKCORNER control
18 DARKCORNER control
19 DARKCORNER control
20 AGI_HUM1_OLIGO_A_23_P153510 81857 NM_030973.2 EU392501.1|EU392500.1|BC065297.1|AK298897.1|AK289460.1|AF261072.1 MED25 mediator complex subunit 25 19 19q13.3 GATGGTCCAGTTCCATTTCACCAACAAGGACCTGGAGTCTCTCAAAGGCCTCTACCGCAT [37.1:chr19:50335597-50335656:+] MED25 MED25

Total number of rows: 45220

Table truncated, full table size 10577 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap