NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8174 Query DataSets for GPL8174
Status Public on Feb 13, 2009
Title NIAID Cgaa -- Candida glabrata 6K
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Nakaseomyces glabratus
Manufacturer NIAID, Genomic Technologies Section (NIH)
Manufacture protocol Microarrays were printed with an Omnigrid robotic arrayer by Genomic Solutions ( http://www.genomicsolutions.com ) that is fitted with a printhead and 32 SMP3 print tips from Telechem ( http://www.arrayit.com ). Candida glabrata expression oligonucleotide probes were purchased from Institut Pasteur. An additional 384 well plate containing control oligos was also included. Oligonucleotide probes in 384-well polypropylene plates (Genetix, 384 micro array) were dissolved in print buffer (150mM sodium phosphate, pH 8.5, 4% sodium sulfate, 0.0001% N-lauryl sarcosyl) to a normalized 25 micromolar concentration. Spot density was 240 microns (center-to-center). The microarrays were printed on Epoxy Slides from Corning (Catalog # 40042) and treated by a method that is an adaptation of the manufacturer's instructions to allow higher throughput processing.
Support glass
Coating epoxide
 
 
Web link http://rtb.niaid.nih.gov
Contributor(s) Jiang G, Myers TG
Submission date Feb 10, 2009
Last update date Feb 13, 2009
Contact name Timothy G Myers
E-mail(s) tgm@nih.gov
Organization name National Institute of Allergy and Infectious Diseases
Department Research Technologies Branch
Lab Genomic Technologies Section
Street address 50 South Drive, Room 5509
City Bethesda
State/province MD
ZIP/Postal code 20892-8005
Country USA
 
Samples (64) GSM371871, GSM371872, GSM371873, GSM371874, GSM371875, GSM371876 
Series (3)
GSE14868 Profiling of Candida glabrata during Phagocytosis by Neutrophils
GSE21352 Azole Resistance Mechanism in Candida glabrata Oropharyngeal Isolates
GSE37071 The Candida glabrata transcription factor Stb5p is a negative regulator of ATP-binding cassette transporters

Data table header descriptions
ID NIH mAdb well id plus replicate number
MADB_WELL_ID NIH mAdb plate-well identifier for oligo sample
OLIGO_ID Oligo identifier
GENE Gene Name
DESCRIPTION Gene Description
GB_ACC RefSeq ID assigned by mAdb
SPOT_ID
SEQUENCE Sequence of the oligo sample

Data table
ID MADB_WELL_ID OLIGO_ID GENE DESCRIPTION GB_ACC SPOT_ID SEQUENCE
1310604_1 1310604 MRF3_50-a12 Tamara prelabeled MRF3_50 Control_4 --Tamara prelabeled MRF3_50 Control_4
1310628_1 1310628 MRF3_50-c12 Tamara prelabeled MRF3_50 Control_4 --Tamara prelabeled MRF3_50 Control_4
1310652_1 1310652 MRF1_50-e12 MRF1_50 Control_4 --MRF1_50 Control_4
1310676_1 1310676 MRF2_50-g12 MRF2_50 Control_4 --MRF2_50 Control_4
1310600_1 1310600 MRF3_50-a08 Tamara prelabeled MRF3_50 Control_4 --Tamara prelabeled MRF3_50 Control_4
1310624_1 1310624 MRF3_50-c08 Tamara prelabeled MRF3_50 Control_4 --Tamara prelabeled MRF3_50 Control_4
1310648_1 1310648 MRF1_50-e08 MRF1_50 Control_4 --MRF1_50 Control_4
1310672_1 1310672 MRF2_50-g08 MRF2_50 Control_4 --MRF2_50 Control_4
1310596_1 1310596 AMB_4F AMB_4F Control_3 Ambion spiked standard --AMB_4F Control_3 Ambion spiked standard
1310620_1 1310620 Alien_8 Alien_8 Control_3 Stratagene spiked standard --Alien_8 Control_3 Stratagene spiked standard
1652559_1 1652559 2868.1-239-308 CAGL0J10978g predicted mRNA. unnamed protein product; weakly similar to sp|Q06648 Saccharomyces cerevisiae YDR309c GIC2 CDC42 GTPase-binding protein or sp|P38785 Saccharomyces cerevisiae YHR061c GIC1, hypothetical start XM_448189 accgttataacaaaatagctagcccagatgccggtaagaaagataagaaattcttcagaagcctgttcaa
1652655_1 1652655 3141.1-668-737 CAGL0K07942g predicted mRNA. unnamed protein product; weakly similar to sp|P38272 Saccharomyces cerevisiae YBR130c SHE3 required for mother cell-specific expression of HO, hypothetical start XM_448566 aaaaatggctattcttatacaaagaggcgcaaagaatatgtgaagaatttgcttcaaaaacagatacgaa
1652751_1 1652751 3479.1-1963-2032 CAGL0G05830g predicted mRNA. unnamed protein product; weakly similar to sp|P38845 Saccharomyces cerevisiae YHR146w, start by similarity XM_446615 cagaacagatttgacagagtgaaggcagaggtccaaggcaatgccatgcacatcaaagatgaagttaggg
1652847_1 1652847 3869.1-1187-1256 CAGL0G01232g predicted mRNA. unnamed protein product; similar to sp|P09620 Saccharomyces cerevisiae YGL203c KEX1 carboxypeptidase, hypothetical start XM_446415 aaaccggtttcacagatgaagttcagatttttgattgggtttatcgtgacgacttaaaatctgataagga
1652551_1 1652551 2814.1-638-707 CAGL0J10252g predicted mRNA. unnamed protein product; highly similar to sp|P53941 Saccharomyces cerevisiae YNL075w IMP4 component of the U3 small nucleolar ribonucleoprotein, start by similarity XM_448157 aaaaggattcttctagggtaataacttttgcaaacagaggtgattttattagtgttagacaacatgtata
1652647_1 1652647 3054.1-524-594 CAGL0K09152g predicted mRNA. unnamed protein product; highly similar to tr|Q08651 Saccharomyces cerevisiae YOR246c, hypothetical start XM_448619 ttatattcaaatatagcaaactggatgaaacttggaactatttcccaaatttcgtattcacttggttccgt
1652743_1 1652743 3384.1-1425-1493 CAGL0A01177g predicted mRNA. unnamed protein product; similar to sp|P32383 Saccharomyces cerevisiae YPL268w PLC1 1-phosphatidylinositol-4, 5-bisphosphate phosphodiesterase, hypothetical start XM_444822 cagcaagaaccagaggatcgcagcgagtatattcaaggacacatttggggatttgctatatacgtgcga
1652839_1 1652839 3774.1-3693-3761 CAGL0F00671g predicted mRNA. unnamed protein product; highly similar to sp|P19524 Saccharomyces cerevisiae YOR326w MYO2 or sp|P32492 Saccharomyces cerevisiae YAL029c MYO4, start by similarity XM_446003 aacattaaaaggtaatgatctaattcctgctggtgcattctggttggcaaatgttagagaattgtactc
1652543_1 1652543 2770.1-252-320 CAGL0L02761g predicted mRNA. unnamed protein product; similar to sp|P18851 Saccharomyces cerevisiae YOR212w STE4, hypothetical start XM_448891 tactaacaaaattgccgatttcagatggagtagggactctaaacttatcttgagcgcgagtcaggatgg
1652639_1 1652639 3007.1-813-882 CAGL0A01804g predicted mRNA. unnamed protein product; highly similar to sp|P32466 Saccharomyces cerevisiae YDR345c HXT3, start by similarity XM_444844 aatcaacaaatgttccccagatcacccatacatccaacaagaactagacttaattcaagctagtgttgat

Total number of rows: 6172

Table truncated, full table size 1445 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap