NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8195 Query DataSets for GPL8195
Status Public on Feb 21, 2009
Title LC_miRRat 9.0_UK_061204-MRA-1003
Technology type in situ oligonucleotide
Distribution commercial
Organisms Rattus norvegicus; synthetic construct
Manufacturer LC sciences
Manufacture protocol Arrays are made based µParaflo microfluidic technology (Atactic Technologies). On the µParaflo microfluidic chip, each detection probe consists of a chemically modified nucleotide coding segment complementary to target microRNA (from miRBase, http://microrna.sanger.ac.uk/sequences/) or other RNA (control or customer defined sequences) and a spacer segment of polyethylene glycol to extend the coding segment away from the substrate. The detection probes are made by in situ synthesis using PGR (photogenerated reagent) chemistry.
 
Description Rat miRNA microarray based on miRBase version 9.0, additional custom sequences

This platform contains 9 probes for each of 238 miRNAs.

This is the Feature Number version (miRNA ID version is GPL9082).
 
Submission date Feb 16, 2009
Last update date Aug 24, 2009
Contact name Christoph Eicken
E-mail(s) ceicken@lcsciences.com
Phone +1 (713) 664-7087
Organization name LC Sciences, LLC
Street address 2575 W. Bellfort
City Houston
State/province TX
ZIP/Postal code 77054
Country USA
 

Data table header descriptions
ID
MetaRow MetaRow
MetaColumn MetaColumn
Row Row of the probe position on the chip
Column Column of the probe position on the chip
miRNA_ID Name according to miRBase
SPOT_ID
Reporter Name Name of the probe on the chip
Reporter BioSequence Database Entry[mirna] Name (according to miRBase) of the targeted miRNA of the probe on the chip
Reporter BioSequence Type BioSequence type of the probe on the chip
Reporter BioSequence Polymer Type BioSequence polymer type of the probe on the chip
Reporter Group [role] General function of the particular probe on the chip: experimental / control
Reporter Control Type Specific function of the particular probe on the chip
Reporter Comment Target sequence (5' to 3') of the probe

Data table
ID MetaRow MetaColumn Row Column miRNA_ID SPOT_ID Reporter Name Reporter BioSequence Database Entry[mirna] Reporter BioSequence Type Reporter BioSequence Polymer Type Reporter Group [role] Reporter Control Type Reporter Comment
1 1 1 1 1 EMPTY empty Ccontrol control_empty
2 1 1 1 2 rno-let-7a rno-let-7a rno-let-7a ss_oligo DNA Experimental Target seq (5' to 3') UGAGGUAGUAGGUUGUAUAGUU
3 1 1 1 3 rno-miR-129 rno-miR-129 rno-miR-129 ss_oligo DNA Experimental Target seq (5' to 3') CUUUUUGCGGUCUGGGCUUGCU
4 1 1 1 4 rno-miR-152 rno-miR-152 rno-miR-152 ss_oligo DNA Experimental Target seq (5' to 3') UCAGUGCAUGACAGAACUUGGG
5 1 1 1 5 rno-miR-19b rno-miR-19b rno-miR-19b ss_oligo DNA Experimental Target seq (5' to 3') UGUGCAAAUCCAUGCAAAACUGA
6 1 1 1 6 rno-miR-222 rno-miR-222 rno-miR-222 ss_oligo DNA Experimental Target seq (5' to 3') AGCUACAUCUGGCUACUGGGUCUC
7 1 1 1 7 rno-miR-30a-3p rno-miR-30a-3p rno-miR-30a-3p ss_oligo DNA Experimental Target seq (5' to 3') CUUUCAGUCGGAUGUUUGCAGC
8 1 1 1 8 rno-miR-340 rno-miR-340 rno-miR-340 ss_oligo DNA Experimental Target seq (5' to 3') UCCGUCUCAGUUACUUUAUAGCC
9 1 1 1 9 rno-miR-376c rno-miR-376c rno-miR-376c ss_oligo DNA Experimental Target seq (5' to 3') AACAUAGAGGAAAUUUCACG
10 1 1 1 10 rno-miR-497 rno-miR-497 rno-miR-497 ss_oligo DNA Experimental Target seq (5' to 3') CAGCAGCACACUGUGGUUUGUA
11 1 1 1 11 EMPTY empty Ccontrol control_empty
12 1 1 1 12 rno-let-7a rno-let-7a rno-let-7a ss_oligo DNA Experimental Target seq (5' to 3') UGAGGUAGUAGGUUGUAUAGUU
13 1 1 1 13 rno-miR-129 rno-miR-129 rno-miR-129 ss_oligo DNA Experimental Target seq (5' to 3') CUUUUUGCGGUCUGGGCUUGCU
14 1 1 1 14 rno-miR-152 rno-miR-152 rno-miR-152 ss_oligo DNA Experimental Target seq (5' to 3') UCAGUGCAUGACAGAACUUGGG
15 1 1 1 15 rno-miR-19b rno-miR-19b rno-miR-19b ss_oligo DNA Experimental Target seq (5' to 3') UGUGCAAAUCCAUGCAAAACUGA
16 1 1 1 16 rno-miR-222 rno-miR-222 rno-miR-222 ss_oligo DNA Experimental Target seq (5' to 3') AGCUACAUCUGGCUACUGGGUCUC
17 1 1 1 17 rno-miR-30a-3p rno-miR-30a-3p rno-miR-30a-3p ss_oligo DNA Experimental Target seq (5' to 3') CUUUCAGUCGGAUGUUUGCAGC
18 1 1 1 18 rno-miR-340 rno-miR-340 rno-miR-340 ss_oligo DNA Experimental Target seq (5' to 3') UCCGUCUCAGUUACUUUAUAGCC
19 1 1 1 19 rno-miR-376c rno-miR-376c rno-miR-376c ss_oligo DNA Experimental Target seq (5' to 3') AACAUAGAGGAAAUUUCACG
20 1 1 1 20 rno-miR-497 rno-miR-497 rno-miR-497 ss_oligo DNA Experimental Target seq (5' to 3') CAGCAGCACACUGUGGUUUGUA

Total number of rows: 3968

Table truncated, full table size 411 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap