NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8755 Query DataSets for GPL8755
Status Public on Oct 16, 2009
Title PF - Agilent-014850 Whole Human Genome Microarray 4x44K
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
Catalog number G4112F
 
Description This multi-pack (4X44K) formatted microarray represents a compiled view of the human genome as it is understood today. The sequence information used to design this product was derived from a broad survey of well known sources such as RefSeq, Goldenpath, Ensembl, Unigene and others. The resulting view of the human genome covers 41K unique genes and transcripts which have been verified and optimized by alignment to the human genome assembly and by Agilent's Empirical Validation process.
Arrays of this design have barcodes that begin with 16014850 or 2514850.
Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.
 
Submission date Jun 23, 2009
Last update date Jan 18, 2013
Contact name St├ęphane VISPE
E-mail(s) stephane.vispe@pierre-fabre.com
Organization name Laboratoires Pierre Fabre
Street address 3 Rue des Satellites
City Toulouse
ZIP/Postal code 31000
Country France
 
Samples (58) GSM419930, GSM419931, GSM419932, GSM419933, GSM419934, GSM419935 
Series (4)
GSE16760 Whole genome analysis in A549 cells treated for short incubation periods with various concentrations of triptolide
GSE24084 RNA expression patterns in serum microvesicles from patients with glioblastoma multiforme and controls
GSE36966 TLS-CHOP Fusion Oncoprotein Regulates MicroRNA-486 in Human Myxoid Liposarcoma

Data table header descriptions
ID
ACCESSIONS Accessions
SEQUENCE Sequence of oligonucleotide
PROBENAME Agilent Probe Name
GENENAME Gene Name
DESCRIPTION Description
CONTROL_TYPE Control type
GB_ACC
SPOT_ID

Data table
ID ACCESSIONS SEQUENCE PROBENAME GENENAME DESCRIPTION CONTROL_TYPE GB_ACC SPOT_ID
1 GE_BrightCorner 1 GE_BrightCorner
2 DarkCorner 1 DarkCorner
3 DarkCorner 1 DarkCorner
4 DarkCorner 1 DarkCorner
5 DarkCorner 1 DarkCorner
6 DarkCorner 1 DarkCorner
7 DarkCorner 1 DarkCorner
8 DarkCorner 1 DarkCorner
9 DarkCorner 1 DarkCorner
10 DarkCorner 1 DarkCorner
11 DarkCorner 1 DarkCorner
12 ref|NM_004900|ref|NM_145699|ens|ENST00000333467|ens|ENST00000249116 GCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCGCTGCAAATGCTGCGGGAT A_24_P66027 APOBEC3B Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B), mRNA [NM_004900] 0 NM_004900
13 gb|AA085955|gb|AL567297|gb|BF871687|gb|BM671900 GGTCAATTTTTGGTCAAAAGTACAGAGAGCATAGAATAAAAGCAAAGATGTGAATGTCTC A_32_P77178 AA085955 AA085955 zl83f11.s1 Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:511245 3', mRNA sequence [AA085955] 0 AA085955
14 ref|NM_014616|ens|ENST00000323116|gb|AB023173|gb|AL133061 ATTTTCTAACTGTCCTCTTTCTTGGGTCTAAAGCTCATAATACACAAAGGCTTCCAGACC A_23_P212522 ATP11B Homo sapiens ATPase, Class VI, type 11B (ATP11B), mRNA [NM_014616] 0 NM_014616
15 gb|AK092846|gb|AX747763|thc|THC2483825 AAGCCAAGTACTTTAGAGAAGAAAAACGGTCTCAGCTGAACCTGTAGTGAGAGCATGCAG A_24_P934473 AK092846 Homo sapiens cDNA FLJ35527 fis, clone SPLEN2001781. [AK092846] 0 AK092846
16 ref|NM_001539|gb|AY186741|gb|BT007292|gb|D13388 ATCCAGGTCAGATTGTCAAGCATGGAGATATCAAGTGTGTACTAAATGAAGGCATGCCAA A_24_P9671 DNAJA1 Homo sapiens DnaJ (Hsp40) homolog, subfamily A, member 1 (DNAJA1), mRNA [NM_001539] 0 NM_001539
17 thc|THC2741789 CCTCTGTCTGGCTTTCTGGATCCTTAGATGAATTGCAGTTGGATTGGAATTTGGCACAAA A_32_P29551 THC2741789 Unknown 0 THC2741789
18 ref|NM_006709|ref|NM_025256|gb|BC018718|ens|ENST00000375530 AAATCGGGCCATCCGCACCAGAGGAAGATCATTCTGCCGGGACGTGGCTCGGGGCTATGA A_24_P801451 EHMT2 Homo sapiens euchromatic histone-lysine N-methyltransferase 2 (EHMT2), transcript variant NG36/G9a, mRNA [NM_006709] 0 NM_006709
19 ref|NM_000978|gb|BC034378|ens|ENST00000245857|ens|ENST00000378096 ACGAAAGTCATACCGTAGAAAAGATGGCGTGTTTCTTTATTTTGAAGATAATGCAGGAGT A_32_P30710 RPL23 Homo sapiens ribosomal protein L23 (RPL23), mRNA [NM_000978] 0 NM_000978
20 gb|T12590 GAATTTCTTCTTCTTCATCAAGAAAGCCATGAGCGAGTTCCCTGAGTCTGAAGCCCCGAA A_32_P89523 T12590 T12590 CHR90110 Chromosome 9 exon II Homo sapiens cDNA clone P94_55 5' and 3', mRNA sequence [T12590] 0 T12590

Total number of rows: 45015

Table truncated, full table size 9682 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap