NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL9288 Query DataSets for GPL9288
Status Public on Oct 20, 2009
Title Hox Tiling Array Agilent-018680 (ChIP)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Mus musculus
Manufacturer Agilent
Manufacture protocol Mouse hox regions A,B,D were identified and 60-mer probes were created that overlapped by 20 (probes were taken from both strands). The worst 3% of probes were removed to avoid cross-hybridization. Probes were uploaded to agilent using earray (http://earray.chem.agilent.com) and arrays were ordered from agilent.
 
 
Submission date Sep 24, 2009
Last update date Oct 20, 2009
Contact name Pengfei Wang
Organization name Stowers Institute
Lab Shilatifard
Street address 1000 E. 50th Street
City Kansas City
State/province MO
ZIP/Postal code 64110
Country USA
 
Samples (10) GSM456244, GSM456245, GSM456246, GSM456247, GSM456248, GSM456249 
Series (2)
GSE18258 Global analysis of H3K4 methylation
GSE18264 ChIP-chip with antibodies for histone 3 lysine 4 trimethylation, histone 3, and PolII in Mll1+/+ and Mll1-/- MEFs

Data table header descriptions
ID
ProbeName probe id
chrom chromosome
position mid-point of probe in mm9 genome
type one of hoxa, hoxb, hoxd, housekeeping gene (selected from Evidence Based Selection of Housekeeping Genes, Jonge et al., 2007), yy1/ies2 gene (selected based on appearance in data sets for YY1/Ies2 knockout in affymetrix arrays and qPCR), agilent control
SEQUENCE probe sequence
RANGE_GB RefSeq Assembly for mm9
RANGE_START start coordinate on RefSeq assembly
RANGE_END end coordinate on RefSeq assembly
RANGE_STRAND strand to which probe corresponds
SPOT_ID identifies type of probe

Data table
ID ProbeName chrom position type SEQUENCE RANGE_GB RANGE_START RANGE_END RANGE_STRAND SPOT_ID
1 MmCGHBrightCorner agilent control control
2 DarkCorner agilent control control
3 DarkCorner agilent control control
4 DarkCorner agilent control control
5 DarkCorner agilent control control
6 DarkCorner agilent control control
7 DarkCorner agilent control control
8 DarkCorner agilent control control
9 DarkCorner agilent control control
10 DarkCorner agilent control control
11 DarkCorner agilent control control
12 e_chr2.74595287.W 2 74595287 hoxd GATTCTCATCACCCGCATAGCAGTTAACAACTGTATCTCCAGTTCCAGGGGACATGATAC NC_000068.6 74595287 74595346 + hoxd
13 e_chr6.51986988.W 6 51986988 hoxa CTCAGATTCCCTAAATAAATTCTAATAAATAGGAAAGAGGATGTGGAAGCCTGCTAACCC NC_000072.5 51986988 51987047 + hoxa
14 e_chr6.51994988.W 6 51994988 hoxa TTTGGTTCAAGTACAAGTGTTAGGGAATGCAGGGTGCAGCACTACCTAATTACAACGGCT NC_000072.5 51994988 51995047 + hoxa
15 e_chr2.74531168.C 2 74531168 hoxd AAATGATCCCTGGGTTCAAGGCAAAAACTAGGGCTGCAAATCTGAGCCAAAGAAAAGCGG NC_000068.6 74531109 74531168 - hoxd
16 e_cnwy_trim29_chr9.43119134.W 9 43119134 yy1/ies2 gene CCTGAAGTCAGGGGAGGGGAAGAGTGGCCTATTTTCCAGCAATGAGTGGCGCAGGCCTAT NC_000075.5 43119134 43119193 + yy1/ies2 gene
17 e_chr11.96249038.C 11 96249038 hoxb ACCAGGGCAACATTCCCCAACCTATGGGGTCTTGATCCTTCTGAGGGTCACATATCAGAT NC_000077.5 96248979 96249038 - hoxb
18 e_cnwy_lnx1_chr5.75071489.W 5 75071489 yy1/ies2 gene GAATTGTGAACATGACCTTATTTAGATAAAATGCGTTAGGACTGAAATTAAACTAGGCTA NC_000071.5 75071489 75071548 + yy1/ies2 gene
19 e_chr6.52082108.W 6 52082108 hoxa AAAATGATGAAATACTATCTCAAAAAAAAAGTCAAATTGGTATAGACCTAATGTTCTCTT NC_000072.5 52082108 52082167 + hoxa
20 e_chr6.52185424.C 6 52185424 hoxa AGGCCAGCTCCAGGCCCAGAAATGTATAGGATAGCTAGCCTGCTACAGGGCCCGTTTAAA NC_000072.5 52185365 52185424 - hoxa

Total number of rows: 45220

Table truncated, full table size 6295 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap