University of California, San Diego Biogem Biomedical Microarray Facility
Manufacture protocol
1. Specific DNA primers were used to amplify ecdysone-regulated control genes by polymerase chain reaction (PCR). 2. Vector-specific primers were used for 5853 cDNA EST clones. More than 30,000 cDNA EST clones were selected for low levels of redundancy by the bioinformatics group at the Berkeley Drosophila Genome Project (BDGP) to obtain this set of 5853. 3. This set was arrayed into 96-well plates by Research Genetics. These clones were obtained from embryonic (LD), female germ line (GM), or head (HL) cDNA libraries provided by the Berkeley/Howard Hughes Medical Institute Drosophila EST Project. 4. Forward and reverse vector-specific primers were made for either the pBS vector (ESTf, GAACAGCTATGACCATGATTACGCC; ESTr, CGGCCAGTGAATTGTAATACGACTC) or the pOT2 vector (OTf, AATGCAGGTTAACCTGGCTTATCG; OTr, AACGCGGCTACAATTAATACATAACC). 5. All PCR primers were picked with Primer3 software developed at the Whitehead Institute and are available at www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi. 6. PCR reactions were done in 96-well plates with reaction volumes of 100 µl per well under the following conditions: 0.2 µg each of forward and reverse primers, 2 mM MgCl2, 10 µl of 10× PCR buffer, 0.25 mM each dNTP, 1.5 U of Taq DNA polymerase, and 0.025 U of Pfu DNA polymerase, for 35 cycles at 94°C for 30 s, at 65°C for 30 s, and at 72°C for 5 min. 7. Several microliters of bacterial liquid culture containing the cDNA EST clone were transferred from a master plate to each well in the PCR reaction plate by means of a 96-pin transfer device. 8. All PCR reactions were analyzed by agarose gel electrophoresis. 9. The following categories of amplified product were obtained: no product, 731; light single band, 604; double band, 221; double band with one much fainter than the other, 412; streak, 5; other anomaly, 19; and single intense band, 3861. 10. These PCR products were then mechanically spotted on glass microscope slides.
Less...
More...