Genome binding/occupancy profiling by high throughput sequencing
Summary
ChIP-seq assay was performed for the quantitative detection of the binding of TFs and histones upon acute stimulations.
Overall design
MCF7 cells were maintained at 37°C and 5% CO2 in Dulbecco's modified Eagle's medium (DMEM, GIBCO/Invitrogen), supplemented with 10% fetal bovine serum (FBS, GIBCO/Invitrogen). LNCAP cells were maintained at 37°C and 5% CO2 in Advanced RPMI 1640 medium (GIBCO/Invitrogen), supplemented with 10% fetal bovine serum (FBS, GIBCO/Invitrogen). For hormone treatments, cells were incubated at 37°C and 5% CO2 for at least 3 days in phenol red-free DMEM (GIBCO/Invitrogen) supplemented with 5% charcoal dextran-stripped FBS (GIBCO/Invitrogen). 17-β-Estradiol (E2; Steraloids, Inc.) was added to a final concentration of 100 nM. TNF⍺ (R&D systems) was added to a final concentration of 20 ng/ml. 5α-dihydrotestosterone (DHT, Sigma) was added to a final concentration of 100 nM. The ethanol (EtOH) vehicle control was 0.05% in all samples. For knock-down of Top1 genes, the siTop1_1 (SASI_Hs01_00047440, Sigma, CACAAAGAGAGGAAUGCUA[dT][dT], UAGCAAUCCUCUCUUUGUG[dT][dT]) and siTop1_3 (SASI_Hs02_00335354, Sigma, GACAAGAUCCGGAACCAGU[dT][dT], ACUGGUUCCGGAUCUUGUC[dT][dT]) were employed. For knock-down of Cbx3 genes, the siCbx3_1 (SASI_Hs01_00170890, Sigma, CCAAGAGGAUUUGCCAGAG[dT][dT], CUCUGGCAAAAUCCUCUUGG[dT][dT]) and siCbx3_2 (SASI_Hs01_00196532, Sigma, CCAAGAGGAUUUGCCAGAG[dT][dT], CUCUGGCAAAAUCCUCUUGG[dT][dT]) were employed. For ChIP-seq and PRO-seq experiments, cells were transfected in 10-cm plates in regular DMEM without antibiotics. 20 μl of 20 μM small interfering RNA (siRNAs) and Lipofectamine® 2000 reagent (Invitrogen Cat# 11668-019) were diluted in Opti-MEM I Reduced Serum Medium (Invitrogen Cat# 11058-021), and incubated for 6 h, and then changed to phenol red-free medium.
Less...
More...