|
| Status |
Public on Nov 27, 2023 |
| Title |
Viral RNA-sequencing for the detection of the viruses replicating in humanized mice |
| Organism |
Human immunodeficiency virus 1 |
| Experiment type |
Other
|
| Summary |
The analysis of RNA-sequencing data reveals the proportion of the three viruses simultaneously inoculated into humanized mice.
|
| |
|
| Overall design |
Three different HIV-1, CH185 wild-type, the CH185 delta PTAP1 mutant (i.e., CH185_dPATAP1), and the CH185 delta PTAP2 mutant (i.e., CH185_dPATAP2) were co-inoculated into nine humanized mice. At two weeks post-infection, the mice were sacrificed after anesthesia and plasma and spleen were collected. To analyze the proportion of the three different viruses in plasma and spleen samples prepared above, the RT-PCR amplicon sequencing that targets the p6 gag region in HIV-1 was performed. As RT-PCR primers, the CH269-PTAP-F “TAGGGAAAATTTGGCCTTCC” and the CH269-PTAP-R “CCTCCAATTCCCCCTATCAT” were used.
|
| |
|
| Contributor(s) |
Sato K, Ito J, Satou Y, Misawa N |
| Citation(s) |
38294901 |
| |
| Submission date |
Dec 01, 2020 |
| Last update date |
Feb 27, 2024 |
| Contact name |
Kei Sato |
| E-mail(s) |
su9ark@gmail.com
|
| Phone |
81364092212
|
| Organization name |
The Institute of Medical Science, The University of Tokyo
|
| Department |
Department of Microbiology and Immunology
|
| Lab |
Division of Systems Virology
|
| Street address |
4-6-1 Shiroganedai
|
| City |
Minato-ku |
| State/province |
Tokyo |
| ZIP/Postal code |
1088639 |
| Country |
Japan |
| |
|
| Platforms (1) |
| GPL23868 |
Illumina MiSeq (Human immunodeficiency virus 1) |
|
| Samples (17)
|
|
| Relations |
| BioProject |
PRJNA681871 |
| SRA |
SRP295389 |
Less...
More...