|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 22, 2014 |
Title |
3C-seq of HT29 cells with CCAT1-L knockdown or scramble knockdown |
Organism |
Homo sapiens |
Experiment type |
Other
|
Summary |
CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells.
|
|
|
Overall design |
The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
|
|
|
Contributor(s) |
Yang L, Xiang J, Zhang X, Chen L |
Citation(s) |
24662484 |
|
Submission date |
Feb 21, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Li Yang |
E-mail(s) |
liyang_fudan@fudan.edu.cn
|
Organization name |
Fudan University
|
Department |
Institutes of Biological Sciences
|
Street address |
131 Dong-An Road
|
City |
Shanghai |
ZIP/Postal code |
200032 |
Country |
China |
|
|
Platforms (1) |
GPL11154 |
Illumina HiSeq 2000 (Homo sapiens) |
|
Samples (1) |
|
Relations |
BioProject |
PRJNA239020 |
SRA |
SRP038760 |
Supplementary file |
Size |
Download |
File type/resource |
GSE55261_CCAT1-L_knockdown_out.bedgraph.gz |
32.5 Kb |
(ftp)(http) |
BEDGRAPH |
GSE55261_Scr_out.bedgraph.gz |
29.3 Kb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|