NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Series GSE64911 Query DataSets for GSE64911
Status Public on Apr 06, 2015
Title Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection
Organism Arabidopsis thaliana
Experiment type Non-coding RNA profiling by high throughput sequencing
Summary AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro.
 
Overall design Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
 
Contributor(s) Garcia-Ruiz H, Fahlgren N, Carrington JC
Citation(s) 25806948, 32533016
Submission date Jan 13, 2015
Last update date Jun 22, 2020
Contact name Hernan Garcia-Ruiz
E-mail(s) hgarciaruiz2@unl.edu
Phone 402 4723008
Organization name University of Nebraska-Lincoln
Department Plant Pathology
Lab Nebraska Center for Virology
Street address 4240 Fair Street
City Lincoln
State/province NE
ZIP/Postal code 68538
Country USA
 
Platforms (1)
GPL13222 Illumina HiSeq 2000 (Arabidopsis thaliana)
Samples (104)
GSM1583064 L9_FC837_Lane4_ED57_Inflorescence_HA-AGO1-DAH(Col-0)_Mock_Input
GSM1583065 L10_FC837_Lane4_ED57_Inflorescence_HA-AGO1-DAH(Col-0)_Mock_Input
GSM1583066 L11_FC837_Lane5_ED57_Inflorescence_HA-AGO1-DAH(Col-0)_TuMV_Input
Relations
BioProject PRJNA272491
SRA SRP052055

Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp
Series Matrix File(s) TXTHelp

Supplementary file Size Download File type/resource
GSE64911_RAW.tar 2.5 Gb (http)(custom) TAR (of GFF3)
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap