 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 10, 2013 |
| Title |
GRO-seq_Vehicle_MCF7_3 |
| Sample type |
SRA |
| |
|
| Source name |
MCF7
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: MCF7
treatment: E2
rna subtype: nascent RNA
time: 0
|
| Treatment protocol |
MCF-7 cells were plated at a density of 1 x 10^6 cells per 15 cm diameter dish in phenol-red free MEM + 5% CDCS, using one dish per experimental condition. After three days, the cells were treated with 100 nM E2 as indicated and washed three times with ice cold PBS.
|
| Growth protocol |
MCF-7 human breast adenocarcinoma cells were kindly provided by Dr. Benita Katzenellenbogen (University of Illinois, Urbana-Champaign). The cells were maintained in minimal essential medium (MEM) with Hank’s salts (Sigma) supplemented with 5% calf serum (CS), sodium bicarbonate, penicillin/streptomycin and gentamicin. Cells were plated for experiments in phenol red-free MEM (Sigma) supplemented with 5% charcoal-dextran treated calf serum (CDCS) prior to 17-b estradiol (E2) treatment.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nuclei extractions were preformed as described (Hah et. al. 2011).
To reduce the ligation bias generated by the relatively low efficiency of single strand RNA ligation, MCF-7 libraries were prepared using a circular ligation based protocol, similar to one that has been described previously (Wang et al., 2011). Briefly, global run-on and base hydrolysis were performed as previously described (Core et al., 2008). Nascent RNA was treated with 5 l antarctic phosphatase (NEB) for 1 hour at 37C before immunopurification by using anti-BrdU antibody-conjugated beads. Purified run-on RNA was subjected to polyA tailing by adding 0.8 l polyA polymerase buffer, 0.8 l 10 mM ATP, 0.5 l SuperRnaseIn and 0.75 l E. coli PolyA Polymerase (NEB) and incubating for 8 min. at 37ºC. PolyA-tailed RNA was extracted by acid phenol-chloroform and subjected to another round of immunopurification by using anti-BrdU antibody conjugated beads to further avoid mRNA contamination. Subsequently, purified polyA-tailed RNA was converted to cDNA by reverse transcription using SuperScript III reverse transcriptase (Invitrogen) and RT primer (pGATCGTCGGACTGTAGAACTCT/idSp/ CCTTGGCACCCGAGAATTCCATTTTTTTTTTTTTTTTTTTTVN) where p indicates phosphorylation, idSp indicates dSpacer Furan, and VN indicates degenerate nucleotides. The RT primer incorporates the Illumina HiSeq 5’ and 3’ adaptors for later PCR amplification and sequencing. Extra RT primers were eliminated by adding 4 l Exonuclease I (Fermentas) with incubation at 37C for 1 h and the RNA templates were eliminated by adding 1.8 l 1 N NaOH with incubation for 20 min. at 98C. Reverse transcribed cDNAs were size selected (120 to 400 bp) by denaturing PAGE (8% acrylamide, 7 M urea, 1X TBE). Purified cDNAs were circularized by adding 1 l CircLigase buffer, 0.5 l 1mM ATP and 0.5 l 50 mM MnCl2 and 0.5 l CircLigase (Epicentre), incubating at 60C for 1 h, and heat-inactivating at 80C for 20 min.. The circularized cDNAs were re-linearized by adding 3.8 l of 4X relinearization supplement (100 mM KCl, 2 mM DTT) and 1.5 l ApeI (NEB), with incubation at 37C for 1 h. After phenol-chloroform extraction, the purified cDNAs were subjected to PCR amplification by using different Illumina TrueSeq small RNA sample barcoded primers from and Phusion high-fidelity polymerase (NEB). PCR was performed by an initial 3 min. denaturation at 98C, subsequent 15 cycles of PCR amplification (80 seconds denaturation at 98C, 90 seconds annealing at 60C, and 30 seconds extension at 72C), and a final 10 min. extension at 65C. PCR products were isolated by native PAGE (6% acrylamide, 1X TBE gel), excised (175 bp to 300 bp), eluted, and purified. The final libraries were sequenced using an Illumina HiSeq per the manufacturer’s instructions.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
GROseq in untreated MCF7 cells
|
| Data processing |
Library strategy: GRO-Seq
The inclusion of the polyA tail in the adapter sequence lead us to devise a new pipeline for processing and mapping reads generated using the circular ligation approach. First, we combined barcoded reads obtained from separate Illumina sequencing lanes, discarding all reads not passing Illumina quality filters. We trimmed adapter sequences and polyA stretches allowing an error rate (-e) of up to 10% using the cutadapt package (Martin, 2011). All reads longer than 32 bp after adapter trimming were aligned to hg18 chromosomes 1-22 and X (the Y chromosome was not included, because MCF-7 cells are derived from a female) using the BWA software package (Li and Durbin, 2009). After read alignment, we noted that one of the 25 minute time point replicates (replicate 2) showed a poor correlation with the other two replicates (the 10 and 40 minute replicates were unaffected). Upon inspection we found a high proportion of reads mapping in ‘spikes’ near polyA sites, leading us to eliminate this replicate from further analysis at this stage. Lastly, reads were converted to ‘wiggle’ tracks counting reads in non-overlapping 200 bp windows across the genome. These tracks were used in subsequent analysis.
Genome_build: hg18
Supplementary_files_format_and_content: bed file
|
| |
|
| Submission date |
Oct 03, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
W. Lee Kraus |
| E-mail(s) |
lee.kraus@utsouthwestern.edu
|
| Organization name |
UT Southwestern Medical Center
|
| Street address |
5323 Harry Hines Blvd.
|
| City |
Dallas |
| State/province |
TX |
| ZIP/Postal code |
75390-8511 |
| Country |
USA |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE41324 |
Signaling Pathways Deferentially Affect RNA Polymerase II Initiation, Pausing, and Elongation in Human Cells: Estrogen dependent signaling in MCF-7 cells |
|
| Relations |
| Reanalyzed by |
GSE66031 |
| SRA |
SRX191082 |
| BioSample |
SAMN01757998 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1014639_E2.0m_R3.noAdapt.bed.gz |
6.8 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
