 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 04, 2013 |
| Title |
Smart-Seq_02 |
| Sample type |
SRA |
| |
|
| Source name |
ES_dilution Total RNA
|
| Organism |
Mus musculus |
| Characteristics |
cell type: Embryonic stem (ES) cell
sample type: dilution Total RNA
starting amount: 10 pg
cell cycle phase: All phase
method subtype: Smart-Seq
|
| Treatment protocol |
For differentiation of 5G6GR ES cells into PrE cells, cells were seeded in the medium supplemented with 100 mM dexamethasone instead of blasticidin, and cultured for 72 h. After culture for 72 h, 5G6GR cells completely differentiated into PrE cells.
|
| Growth protocol |
We used EB5 ES cells for preparation of total RNA. This cell line is derived from E14tg2a ES cells, in which one endogenous Pou5f1 allele is disrupted by a blasticidin resistance gene. We used 5G6GR ES cells for single-cell Quartz-Seq. The cell line is generated by random integration of the linearized Gata6-GR-IRES-Puro vector into EB5 ES cells. These cells were cultured on gelatin-coated dishes in the absence of feeder cells in Glasgow minimal essential medium (GMEM, Sigma) supplemented with 10 % fetal calf serum, 1000 U/ml Leukemia Inhibitory Factor (ESGRO, Invitrogen), 100 uM 2-mercaptoethanol (nacalai tesque), 1x non-essential amino acids (Invitrogen), 1 mM sodium pyruvate (Invitrogen), 2 mM L-glutamine (nacalai tesque), 0.5x Penicillin/Streptomycin (Invitrogen), and 10 ug/ml blasticidin (Invivogen). For the culture of 5G6GR ES cells, 0.5 ug/ml puromycin (Sigma) was additionally supplemented to the culture.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cultured cells were dissected out using trypsin-EDTA at 37°C for 3 min. Subsequently, resulted cells were washed with PBS buffer. 0.5x10^6 cell was stained with 1 ml of PBS buffer with Hoechst 33342 10 ug/ml at 37°C for 15 min. Stained cells were sorted by reference to information of Hoechst 33342 area. To increase the success rate of amplification, we added several bubbles to single-cell lysis buffer using micropipette. We collected single-cell to 0.4 ul lysis buffer with bubble, which prechilled on 4C IsoFreeze rack. Subsequently, we performed whole-transcript amplification with single-cell lysis sample. For a decrement of RNase contamination risk, working bench environment and all experimental equipments were kept clean using RNase removal reagent RNase Out (Molecular Bio Products). We used low retention single-PCR-tube or 8-linked-PCR-tube for single-cell amplification (TaKaRa). Cells and 10 pg total RNA was dissolved in 0.4 ul single-cell lysis buffer (0.5 % NP40) on 0°C aluminum PCR-rack, which put on ice. These solutions were mixed by bench-top mixer Mixmate (Eppendorf ) at 2500 rpm under 4°C for 15 sec. Immediately, After 3000 G centrifugation for 10 sec under 4°C, 0.8 ul of priming buffer (1.5x PCR-buffer with MgCl2 Takara, 41.67 pM RT primer (HPLC purified, TATAGAATTCGCGGCCGCTCGCGATAATACGACTCACTATAGGGCGTTTTTTTTTTTTTTTTTTTTTTTT), 4 u/ul RNasin-plus (Promega), 50uM dNTPs) was added to each tubes. Solution was mixed at 2500 rpm for 15 sec under 4°C. Denature and priming was performed at 70°C for 90 sec, 35°C for 15 sec using thermal cycler (C1000 and S1000 BioRad) and the reaction-tubes were put on 0°C aluminum PCR-rack . 0.8 ul of RT buffer (1x PCR-buffer, 25 u/ul SuperScript III (Life technologies), 12.5mM DTT) was added to each tubes. Reverse-transcription was performed at 35°C for 5 min, 45°C 20 min and heat-inactivated at 70°C for 10 min. After that, the reaction-tubes were put on 0°C aluminum PCR-rack. We always used latest lots of SuperScript III for single-cell amplification. After 3000 G centrifugation for 10 sec under 4°C, 1 ul of exonuclease solution (1x Exonuclease-buffer(Takara), 1.5 u/ul exonuclease I (Takara)) was added to each tubes. Primer digestion was performed at 37°C for 30 min and heat-inactivated at 80°C for 10 min. The reaction-tubes were put on 0°C aluminum PCR-rack. After 3000 G centrifugation for 30 sec under 4°C, 2.5 ul of poly-A tailing buffer (1x PCR-buffer, 33.6 u/ul Terminal transferase (Roche), 0.048 u RNase H (Invitrogen)) was added to each tubes at 0°C aluminum PCR-rack. The reaction-tubes were mixed at 2500 rpm under 4°C for 15 sec. Immediately, after 3000 G centrifugation for 10 sec under 0°C, the reaction-tubes were put on 0°C pre-chilled thermal cycler block. Subsequently, poly-A tailing reaction was performed at 37°C for 50 sec and heat-inactivated at 65°C for 10 min. The reaction-tubes were put on 0°C aluminum PCR-rack. After 3000 G centrifugation for 30 sec under 4°C, the reaction-tubes were put on 0°C aluminum PCR-rack. 23 ul of second strand buffer (1.09x MightyAmp Buffer v2, 70 pM tagging primer (HPLC purified, TATAGAATTCGCGGCCGCTCGCGATTTTTTTTTTTTTTTTTTTTTTTT), 0.054 u/ul MighyAmp DNA polymerase). The reaction-tubes were mixed at 2500 rpm under 4°C for 15 sec. After 3000 G centrifugation for 10 sec under 4°C, Second strand synthesis was performed at 98°C for 2 min, 10 sec, 40°C for 1 min and 68°C for 5 min. Immediately, the reaction-tubes were put on 0°C aluminum PCR-rack. Add 25 ul of PCR buffer (1x MightyAmp Buffer v2, 1.9 uM sPCR primer (HPLC purified, (NH2)-GTATAGAATTCGCGGCCGCTCGCGAT)). The reaction-tubes were mixed at 2500 rpm under 4°C for 15 sec. After 3000 G centrifugation for 10 sec under 4°C, PCR enrichment was performed following condition (98°C for 10 sec, 65°C for 15 sec and 68°C for 5 min per cycle). PCR cycle number is under 21 cycle. After that, the reaction-tubes were incubated at 68°C for 5 min. The reaction-tubes were put on 25°C aluminum PCR-rack. The amplified cDNA was purified using MinElute PCR purification column (Qiagen) or Agencourt Ampure XP (Beckman). To detect in each platform, amplified cDNA was used for each subsequent process. The cost of our amplification method was about ￥500 per single-cell. For Smart-Seq analysis, we amplified cDNA from ES 10 pg total RNA using SMARTer Ultra Low RNA Kit for Illumina Sequencing (Clontech). After 19 cycle PCR enrichment with ES 10 pg total RNA, we got about 2 ng amplified cDNA.
For library preparation of conventional RNA-Seq (without WTA), we used TruSeq RNA sample kit (Illumina). Library preparation was performed according to Illumina protocol except PCR enrichment. For PCR enrichment, we used KAPA HiFi DNA polymerase (KAPA BIOSYSTEMS). For library preparation of Quartz-Seq (with WTA) and Smart-Seq (with WTA), we prepared sequencing library DNA using our optimized library preparation method, named LIMprep (Ligation-based Illumina Multiplex library PREParation). In LIMprep, we used KAPA library preparation kit (KAPA Biosystems), self-produced TruSeq adaptors and PCR primers. For Quartz-Seq, 20 ng of Amplified cDNA was diluted into 130 ul TE buffer. The solutions were transferred into snap cap microTUBEs (Covaris). Amplified cDNA in microTUBEs was fragmented by S220 Focused-ultrasonicators (Covaris). Process configuration was as follow, Duty Factor 10 %, Peak Incident Power 175, Cycles per Burst 100, Time 600 second. Fragmented cDNA was purified into 10 ul of nuclease free water by using DNA Clean & Concentrator 5 (Zymo research). 40 ul of end repair reaction mix (1.25x End Repair Buffer, 1.25 x End Repair Enzyme Mix ) was added to 10 ul of fragmented cDNA solution. End repair reaction was performed at 20°C for 30 min. After that, end-repaired DNA was purified into 12.5 ul of EB1/10 buffer (1 mM TrisHCl pH8.0) using DNA Clean & Concentrator 5. 12.5 ul of A-tailing mix (2x A-tailing Buffer, 2x A-tailing Enzyme) was added to 12.5 ul of end-repaired DNA solution. A-tailing reaction was performed at 30°C for 30 min. After that, A-tailing DNA was purified into 12.5 ul of EB1/10 buffer using DNA Clean & Concentrator 5. 12.5 ul of adaptor ligation mix (2x Ligation Buffer, 2x DNA Ligase, 10 pmol of each self-produced adaptor) was added to 12.5 ul of A-tailed DNA solution under 4°C. Adaptor ligation was performed at 20°C for 15 min. For adaptor ligation, we used 10 pmol of self-produced TruSeq adaptor per sample. Each Self-produced TruSeq adaptor was prepared using following HPLC-purified primers (Hokkaido System Science);
TRSU: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T
TRSI-2: (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTT*G
TRSI-4: (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTT*G
TRSI-5: (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTT*G
TRSI-6: (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTT*G
TRSI-7: (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTT*G
TRSI-12: (5'-phosphate)GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTT*G
Asterisks indicate phosphorothioate bond. Each primers are dissolved with Adaptor Buffer (10 mM Tris-HCl pH 7.8, 0.1 mM EDTA pH8.0, 50 mM NaCl) to 100 uM concentration. We equally mixed 100uM TRSU and 100 uM each TRSI primer on PCR tubes, respectively. After mixing, these primers were incubated at 95°C for 2 min. After that, primer annealing was performed following condition (95°C for 2 min and temperature drop of -0.5°C per cycle for 170 cycles). After that, the reaction-tubes were incubated at 4°C for 5 min. Resulted adaptors were diluted with adaptor buffer to 10 uM concentration. We dispensed 1 ul of 10 uM each adaptors at -80 °C before use. Removal of adaptor dimer was performed as follows. 25 ul of binding support buffer (1 M NaCl, 20 mM MgCl2, 20 mM TrisHCl pH7.8) and 60 ul Agencort Ampure XP bead solution were added to 25 ul of adaptor-ligated DNA solution. After 15 min incubation at 25 °C, the beads were separated using magnetic stand for over 10 min. The beads were washed with 80 % EtOH for 1 min twice. Adaptor-ligated DNA was eluted with 25 ul of EB1/10. The purification for removal of adaptor dimer was repeated again. Finally, adaptor-ligated DNA was eluted to 20 ul of EB1/10. 30 ul of PCR solution (1.666x KAPA HiFi DNA polymerase ready mix, 17.5 pmol TPC1 primer, 17.5 pmol TPC2 primer) was added to 20 ul of adaptor-ligated DNA. Primer sequences were as follows. TPC1 : AATGATACGGCGACCACCGA*G TPC2 : CAAGCAGAAGACGGCATACGA*G Asterisks indicate phosphorothioate bond. Each primers are dissolved with Adaptor Buffer (10 mM Tris-HCl pH7.8, 0.1 mM EDTA pH8.0, 50 mM NaCl) to 100 uM concentration. Before PCR enrichment, reaction tubes were incubated at 98°C for 45 sec. PCR enrichment was performed following condition (98°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec per cycle). Typical PCR cycle number is 10-12 cycle. After PCR enrichment, sequencing library DNA was purified using Ampure XP beads. Accurate concentration of sequencing library DNA including TruSeq Index sequence was estimated by KAPA library quantification kit (KAPA). The Pearson correlation coefficient of three technical replications of LIMprep were 0.9976 ± 0.0005.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 1000 |
| |
|
| Data processing |
Basecalls performed using CASAVA version 1.8.2
All raw sequencing reads were trimmed sequencing primer and WTA primer using by Trimmomatic.
After trimmed sequencing primer and WTA primer, all reads were aligned to the mm9 genome assembly using tophat version 2.0.1
The FPKM (Fragments Per Kilobase of exon per Million mapped fragments) were calculated by Cufflinks 2.0.1 with transcriptome reference (Ensembl Mouse Transcript)
Genome_build: mm9
Supplementary_files_format_and_content: FPKM
|
| |
|
| Submission date |
Nov 14, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Itoshi NIKAIDO |
| E-mail(s) |
itoshi.nikaido@riken.jp
|
| Organization name |
RIKEN
|
| Department |
Center for Biosystems Dynamics Research
|
| Lab |
Laboratory for Bioinformatics Research
|
| Street address |
2-1 Hirosawa
|
| City |
Wako |
| State/province |
Saitama |
| ZIP/Postal code |
351-0198 |
| Country |
Japan |
| |
|
| Platform ID |
GPL15103 |
| Series (1) |
| GSE42268 |
Quartz-Seq: a simple and highly quantitative method for single-cell RNA-Seq |
|
| Relations |
| SRA |
SRX204473 |
| BioSample |
SAMN01814259 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1036519_Smart_Seq_02.txt.gz |
287.9 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
