GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1068668

Query DataSets for GSM1068668

Status

Public on Nov 08, 2013

Title

mRNARP-L4h

Sample type

SRA

Source name

ribosome-protectedl mRNAs from 4-day old etiolated seedling with 4-h light treatment

Organism

Arabidopsis thaliana

Characteristics

ecotype: Columbia-0
sample type: ribosome-protected mRNA
treatment: with 4h light

Treatment protocol

4-day-old dark-grown seedlings illuminated with/without 4-h white light (80 mmole m-1 sec-1)

Growth protocol

Col-0 were grown on 1/2 MS medium in darkness for 4 days

Extracted molecule

total RNA

Extraction protocol

Seedlings were quickly harvested in liquid nitrogen. The Arabidopsis polysome complexes were extracted with polysome extraction buffer and digested with RNase I. The ribosome protected fragments were purified with SDS/phenol method. Messenger RNAs purified with Illustra mRNA purification kit were fragmented with NEBNext RNA Fragmentation Reaction Buffer (NEB, MA, USA) at 940C for 40 min.
RNA libraries were prepared for deep sequencing using a protocol from Ingolia et al., Cell, 2011.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2000

Data processing

Adaptor sequences (5'CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTT
CCTTGGCACCCGAGAATTCCAATTGATGGTGCCTACAG3') were trimmed from the sequence reads
Only the unique reads with 95% and above identity were aligned to the representative gene models.
The 15th nucleotide of aligned reads was assigned for the calculation of the read count for every nucleotide of each individual transcript.
RPKM (reads per kilobase per million mapped reads) were used to represent the read intensity in 5' UTR, CDS and 3' UTR.
Genome_build: Reference transcript datasets including the 5’ UTRs, CDS and 3’ UTRs for 27,416 annotated protein-coding gene models were retrieved from The Arabidopsis Information Resources (TAIR10; http://www.arabidopsis.org). We have updated gene models of 3,111 genes originally lacking 5’/3’ UTRs in Tair10 with the use of our sequencing datasets.
Supplementary_files_format_and_content: The "Processed data_Whole_genome" contains the length, read counts and RPKM of 5' UTR, CDS and 3' UTR for 27,416 represent gene models in 4 samples (mRNASS_Dark, mRNASS_L4h, mRNARP_Dark, mRNARP_L4h).

Submission date

Jan 23, 2013

Last update date

May 15, 2019

Contact name

Ming-Jung Liu

E-mail(s)

mjliu@gate.sinica.edu.tw

Organization name

Academia sinica

Street address

128 Sec. 2, Academia Rd, Nankang