|
Status |
Public on Aug 13, 2013 |
Title |
HCT116_GA3814_RNAseq |
Sample type |
SRA |
|
|
Source name |
HCT116 cells
|
Organism |
Homo sapiens |
Characteristics |
cell line: HCT116 genotype/variation: wild type
|
Treatment protocol |
(1) Primary IMR90 cells were seeded at 1 × 10^5 cells per well of a 6-well plate, incubated for 24 hours in Eagle's Minimum Essential Medium (EMEM, ATCC) high glucose with 10% serum, and then supplemented with fresh media containing 20 μM 5azadC (Sigma-Aldrich) for 72 hours. Media containing drug was changed every 24 hours. (2) For HDAC inhibition, IMR90 or HCT116-WT cells were seeded at a density of 2 × 10^6 cells in 100-mm plates with EMEM or McCoy’s 5A medium (ATCC) supplemented with 10% serum, respectively, incubated overnight, and mock treated (media only; ‘CTR’) or treated with 300 nM TSA (Sigma-Aldrich) for 6 hours in an CO2 incubator at 37°C. MeCP2 shRNA, 5’- CATTAGGGTCCAGGGATGTGT - 3’; shRNA constructs were designed and cloned into the pGreenPuro lentiviral vector according to specifications provided by System Biosciences and their shLuc construct was used as a negative, non-specific control. Sequences were confirmed by automated DNA sequencing (not shown). (3) The shMeCP2 and shLuc constructs were transfected into HEK-293T cells for packaging according to System Biosciences’ instructions. Viral supernatants were collected for infection of IMR90 cells. 2 × 10^6 early passage IMR90 cells or HCT116-WT cells were seeded in the presence of viral supernatant and 8 μg/ml polybrene per well of a 12-well plate. After 24 hours, cells were trypsinized and transferred into 6-well plates with fresh media and 5 μg/ml puromycin. Selection was visually monitored by GFP positivity and cells were collected for experiments at day 3 post-infection when >95% of cells by count were GFP positive.
|
Growth protocol |
Human IMR90 cells (American Type Culture Collection; ATCC) were cultured under optimal growth conditions as specified by ATCC, and only cells at early passage were used for experiments15. HCT116-WT and HCT116-DKO (DKO1 line) cells were generous gifts from Dr. B. Vogelstein (Johns Hopkins University)17. These cells were cultured in McCoy's 5A medium with 10% FBS.
|
Extracted molecule |
polyA RNA |
Extraction protocol |
Total mRNA was isolated from all cells using the RNeasy kit (Qiagen) and converted to cDNA using the Superscript ds-cDNA synthesis kit (Invitrogen) according to the manufacturer’s instructions. For RNA-Seq, double-stranded DNAs were fragmented to 100–200 bp using sonication, followed by end-repair, Illumina adaptor ligation, and sequencing using the Illumina HiSeq 2000 platform according to the manufacturer’s protocol for paired-end reads.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
RNA-Seq reads were aligned to hg18 genome using TopHat algorithm (version 1.3.1) with '-g 1' option. Genome_build: hg18 Supplementary_files_format_and_content: exon junction BED files generated using Tophat
|
|
|
Submission date |
May 29, 2013 |
Last update date |
May 15, 2019 |
Contact name |
Iouri Chepelev |
E-mail(s) |
ichepelev@gmail.com
|
Organization name |
US Department of Veterans Affairs Medical Center
|
Street address |
3200 Vine St
|
City |
Cincinnati |
State/province |
OH |
ZIP/Postal code |
45220 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (2) |
GSE47488 |
Intragenic DNA methylation modulates alternative splicing by recruiting MeCP2 to promote exon recognition [RNA-Seq] |
GSE47678 |
Intragenic DNA methylation modulates alternative splicing by recruiting MeCP2 to promote exon recognition |
|
Relations |
BioSample |
SAMN02183038 |
SRA |
SRX287282 |