 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 30, 2013 |
| Title |
Yukon Cabinet 1 |
| Sample type |
SRA |
| |
|
| Source name |
Yukon cabinet rosette leaves
|
| Organism |
Eutrema salsugineum |
| Characteristics |
accession: Yukon
tissue: rosette leaf tissue
|
| Growth protocol |
Cabinets: Seeds in pots were stratified for 2 d at 4°C before transfer to growth chambers set with a 21 h day and irradiance of 250 μmol m-2s-1 and 22°C/10°C day/night temperature regime. Plants were watered daily as needed and fertilized one time per week with 1 g L-1 20-20-20 (NPK) fertilizer
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Extractions of nucleic acids from Eutrema proved to be unsatisfactory using methods commonly employed for Arabidopsis. These issues were circumvented using a modification of the method described for cotton leaves in Wan and Wilkins (1994). Briefly, approximately 0.5 g of frozen leaf tissue in liquid nitrogen was ground to fine powder in a mortar and pestle and RNA was extracted according to the manufacturer's recommendation with 8 mL Tri Reagent (Sigma). This first crude preparation of total RNA was resuspended in 1 mL nuclease-free water and purified of polyphenolics and carbohydrates using a "hot borate" step (200 mM sodium borate decahydrate, 30 mM Na-EGTA, 1% (w/v) SDS, 1% (w/v) sodium deoxycholate, 2% (w/v) polyvinylpyrrolidone (PVP 40000), 0.1% (w/v) DEPC, pH 9.0) followed by sequential RNA precipitations with 2 M lithium chloride then ethanol. From approximately 150 μg of this high quality total RNA, mRNAs were purified in 3-4 repeated rounds of oligo-dT selection using a Sigma mRNA miniprep kit (MRN-10). Abundance and quality of RNA following total RNA extraction was assessed using RNA 6000 Nano chips (Agilent) on a Bioanalyzer 2100 instrument and mRNA selections were continued until no rRNA peaks were visible on Bioanalyzer electropherograms.
Procedures for RNA fragmentation, cDNA synthesis, sequencing adaptor ligation andsize selection closely followed the Roche cDNA Rapid Library Preparation Manual,December 2010. Briefly, 200 ng of mRNA was chemically fragmented with ZnCl2 andused as a template to synthesize double-stranded cDNA using Roche Primer "random". The product of each cDNA synthesis was end-repaired and indexed with the regularRapid Library Adaptor with one exception: Libraries Shandong-2 and Shandong-3 wereindexed by ligation of Roche MID Adaptors 2 and Adaptors 3, respectively. Each cDNAlibrary was quantified by fluorometry on a Biotek Synergy 2 fluorometric plate reader.Size selection of each library in the 600-1200 bp range was verified by running a smallaliquot on a High Sensitivity DNA chip (Agilent) on the Bioanalyzer 2100. All sequencing libraries were in the range of 108 to 109 molecules/mL and stored in this concentrated form in TE buffer at -80 °C for several days to approximately 1 month until further analysis. Quantitative real-time RT-PCR was conducted on a Bio-Rad CFX96 instrument using primers specific for Eutrema ACTIN1 (F -ACAGGGTGCTCTTCAGGAGCGAT; R - GCATGGTGTTGTGAGCAACTGGG), whose product spans an intron. Contaminating genomic DNA was not detected in any sequencing library.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
454 GS FLX Titanium |
| |
|
| Description |
Three repeats were sequenced for each experimental condition
|
| Data processing |
Sequences were trimmed using GS De Novo Assembler v2.6 using default parameters and SeqTrim with minimum quality 20, window size 10, minimum length 80 bp, no contamination removal.
GMAP v2011-11-30 (http://research-pub.gene.com/gmap/src/gmap-gsnap-2011-11-30.tar.gz) was used to map reads to reference genome (ftp://ftp.jgi-psf.org/pub/compgen/phytozome/v7.0/Thalophila/assembly/Thalophila_173_RM.fa.gz).
Reads were counted using htseq-count (http://www-huber.embl.de/users/anders/HTSeq/doc/count.html) with genome annotation file (ftp://ftp.jgi-psf.org/pub/compgen/phytozome/v7.0/Thalophila/annotation/Thalophila_173_gene.gff3.gz).
Reads Per Kilobase of exon per Megabase of library size (RPKM) were calculated by dividing number of mapped reads by the median mRNA length and library size.
The expression for genes Thhalv10002723m and Thhalv10002628m were manually adjusted; please refer to the associated publication.
Genome_build: Phytozome v7.0, available at ftp://ftp.jgi-psf.org/pub/compgen/phytozome/v7.0/Thalophila/.
Supplementary_files_format_and_content: Two column tab-delimited text files including gene names from GFF3 file and associated RPKM values for a given Sample.
|
| |
|
| Submission date |
Jul 30, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Elizabeth A Weretilnyk |
| E-mail(s) |
weretil@mcmaster.ca
|
| Organization name |
McMaster University
|
| Department |
Biology
|
| Street address |
1280 Main Street West
|
| City |
Hamilton |
| State/province |
Ontario |
| ZIP/Postal code |
L8S4K1 |
| Country |
Canada |
| |
|
| Platform ID |
GPL17514 |
| Series (1) |
| GSE49378 |
RNA-Seq effectively monitors gene expression in Eutrema salsuginuem plants growing in an extreme natural habitat and in controlled growth cabinet conditions |
|
| Relations |
| BioSample |
SAMN02297989 |
| SRA |
SRX329496 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1198452_Y-Cab-1_rpkm.txt.gz |
237.0 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
