RKO cells were transfected with siRNA targeting either POLQ by two independent pools of siRNA : POLQ-1 siRNA: ON-TARGET plus smart pool of 4 POLQ siRNA from Dharmacon (Thermo Fisher Scientific, Waltham, USA): CCUUAAGACUGUAGGUACU, ACACAGUAGGCGAGAGUAU, CGACUAAGAUAGAUCAUUU, CAAACAACCCUUAUCGUAAA; siRNA POLQ-2: ON-TARGET plus smart pool of 4 POLQ siRNA from Dharmacon: UCAGAGGGAUGGAGCUAAU, GAGAUUACCCUUUCACCUA, CAAUUUUACAGUACGGAAA, UGAUAGAUUAGCCUAGUA) or Luciferase (CTRL) (5’-CGUACGCGGAAUACUUCGAdTdT-3’ from Sigma-Aldrich, Saint-Louis, USA) at the final concentration of 50nM, by using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, USA) following the manufacturer’s suggestions. Transfection medium was changed 8 hours later to complete medium.
Growth protocol
Human RKO cell line was purchased from ATCC and grown in Dulbecco’s Modified Eagle Medium with GlutaMAX™ I, High glucose, Sodium Pyruvate (Gibco, Life technologies, Paisley, UK), supplemented with 10% Foetal Bovine Serum (Lonza, Basel, CH), penicillin (100U/ml) and streptomycin (100µg/ml) (Gibco) at 37°C, 5% CO2 and 5% O2 (standard culture conditions).
Extracted molecule
genomic DNA
Extraction protocol
24h after transfection with POLQ-1 or CTRL siRNA, RKO cells were incubated with BrdU (50µM) for one hour, then collected, washed three times in PBS, fixed in 75% ethanol, and stored at −20°C. Fixed cells were re-suspended in PBS first with RNAse (0.5 mg/ml) and then with propidium iodide (PI) (50 µg/ml) following by an incubation of 30 min at room temperature. 80,000 cells were sorted in two fractions S1 and S2 using INFLUX 500 (Cytopeia purchased by BD Biosciences) corresponding to Early and Late fractions respectively. Neo-synthesized DNA was immunoprecipited by BrdU antibodies (Anti BrdU Pure, BD Biosciences, # 347580) as described by Hiratani et al 2008. To control the quality of enrichment of early and late fractions in S1 and S2, qPCR was performed with CAV2 oligonucleotides (early control) and with bgGRM8 oligonucleotides (late control).
Label
Cy3
Label protocol
Microarray hybridization requires a minimum of 500 ng of DNA and to obtain sufficient specific immunoprecipited DNA, whole genome amplification was conducted (WGA, Sigma). To be sure that this step does not introduce bias, an after WGA qPCR was performed to confirm the specific enrichment in each fractions S1 and S2. After amplification, early and late neo-synthesized DNA were labeled with Cy3 and Cy5 ULS molecules (Genomic DNA labeling Kit, Agilent) as recommended by the manufacturer.
RKO cells were transfected with siRNA targeting either POLQ by two independent pools of siRNA : POLQ-1 siRNA: ON-TARGET plus smart pool of 4 POLQ siRNA from Dharmacon (Thermo Fisher Scientific, Waltham, USA): CCUUAAGACUGUAGGUACU, ACACAGUAGGCGAGAGUAU, CGACUAAGAUAGAUCAUUU, CAAACAACCCUUAUCGUAAA; siRNA POLQ-2: ON-TARGET plus smart pool of 4 POLQ siRNA from Dharmacon: UCAGAGGGAUGGAGCUAAU, GAGAUUACCCUUUCACCUA, CAAUUUUACAGUACGGAAA, UGAUAGAUUAGCCUAGUA) or Luciferase (CTRL) (5’-CGUACGCGGAAUACUUCGAdTdT-3’ from Sigma-Aldrich, Saint-Louis, USA) at the final concentration of 50nM, by using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, USA) following the manufacturer’s suggestions. Transfection medium was changed 8 hours later to complete medium.
Growth protocol
Human RKO cell line was purchased from ATCC and grown in Dulbecco’s Modified Eagle Medium with GlutaMAX™ I, High glucose, Sodium Pyruvate (Gibco, Life technologies, Paisley, UK), supplemented with 10% Foetal Bovine Serum (Lonza, Basel, CH), penicillin (100U/ml) and streptomycin (100µg/ml) (Gibco) at 37°C, 5% CO2 and 5% O2 (standard culture conditions).
Extracted molecule
genomic DNA
Extraction protocol
24h after transfection with POLQ-1 or CTRL siRNA, RKO cells were incubated with BrdU (50µM) for one hour, then collected, washed three times in PBS, fixed in 75% ethanol, and stored at −20°C. Fixed cells were re-suspended in PBS first with RNAse (0.5 mg/ml) and then with propidium iodide (PI) (50 µg/ml) following by an incubation of 30 min at room temperature. 80,000 cells were sorted in two fractions S1 and S2 using INFLUX 500 (Cytopeia purchased by BD Biosciences) corresponding to Early and Late fractions respectively. Neo-synthesized DNA was immunoprecipited by BrdU antibodies (Anti BrdU Pure, BD Biosciences, # 347580) as described by Hiratani et al 2008. To control the quality of enrichment of early and late fractions in S1 and S2, qPCR was performed with CAV2 oligonucleotides (early control) and with bgGRM8 oligonucleotides (late control).
Label
Cy5
Label protocol
Microarray hybridization requires a minimum of 500 ng of DNA and to obtain sufficient specific immunoprecipited DNA, whole genome amplification was conducted (WGA, Sigma). To be sure that this step does not introduce bias, an after WGA qPCR was performed to confirm the specific enrichment in each fractions S1 and S2. After amplification, early and late neo-synthesized DNA were labeled with Cy3 and Cy5 ULS molecules (Genomic DNA labeling Kit, Agilent) as recommended by the manufacturer.
Hybridization protocol
The hybridization was performed according to the manufacturer instructions on 4× 180K human microarray (SurePrint G3 Human CGH Microarray Kit, 4x180K, AGILENT Technologies, genome reference Hg18) that covers the whole genome with one probe every 13 Kb (11 KB in RefSeq sequences).
Scan protocol
Microarrays were scanned with an Agilent's High-Resolution C Scanner using a resolution of 2 µm and the autofocus option.
Description
Biological replicate 2 of 2. Control siRNA
Data processing
Feature extraction was performed with the Feature Extraction 9.1 software (Agilent technologies). For each experiment, the raw data sets were automatically normalized by the Feature extraction software. Analysis was performed with the Agilent Genomic Workbench 5.0 software.
