 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 31, 2013 |
| Title |
miRQC B repeat |
| Sample type |
SRA |
| |
|
| Source name |
miRQC B repeat
|
| Organism |
Homo sapiens |
| Characteristics |
biomaterial: HuBr - human brain total RNA (Life Technologies, #AM6050)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Illumina TruSeq Small RNA Kit with TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCC as the 3' adapter. 3' then 5' Adapter Ligation, RT, followed by PCR.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Data processing |
Basecalls performed using CASAVA version 1.8
Quality control, alignment and quantification were performed using the Avadis NGS Software (v 1.4) from Strand Life Sciences
3' adapter was trimmed allowing for 2 mismatches in the adapter sequence
Trimmed reads were aligned against the hg19 reference sequence allowing for 1 mismatch
Reads matching more than 10 locations in the genome were discarded
For all other reads, upto 5 best matches were considered
A read was assigned to a miRNA only if the 5' end of the read matched the 5' end of the miRNA
Genome_build: hg19, miRBase (version 18) annotations were used to assign reads to miRNA genes
Supplementary_files_format_and_content: tab-delimited file containing the miRNA name and number of reads assigned to it by the Avadis NGS quantification method
|
| |
|
| Submission date |
Aug 12, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Aishwarya Narayanan |
| Organization name |
Strand Life Sciences
|
| Street address |
5th Floor, KBP, Bellary Road
|
| City |
Bangalore |
| ZIP/Postal code |
560024 |
| Country |
India |
| |
|
| Platform ID |
GPL10999 |
| Series (1) |
| GSE49816 |
Evaluation of quantitative miRNA gene expression platforms in the microRNA Quality Control (miRQC) study |
|
| Relations |
| BioSample |
SAMN02316016 |
| SRA |
SRX334036 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1207646_s4.counts.tsv.gz |
13.7 Kb |
(ftp)(http) |
TSV |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
