NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1207659 Query DataSets for GSM1207659
Status Public on Aug 31, 2013
Title serum + spiked miRs constant concentration
Sample type SRA
 
Source name serum + spiked miRs constant concentration
Organism Homo sapiens
Characteristics biomaterial: Synthetic miRNA templates for miR-10a-5p, let-7a-5p, miR-302a-3p and miR-133a were spiked in serum RNA at 6000 copies per ul serum RNA
Extracted molecule total RNA
Extraction protocol Illumina TruSeq Small RNA Kit with TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCC as the 3' adapter. 3' then 5' Adapter Ligation, RT, followed by PCR.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer IIx
 
Data processing Basecalls performed using CASAVA version 1.8
Quality control, alignment and quantification were performed using the Avadis NGS Software (v 1.4) from Strand Life Sciences
3' adapter was trimmed allowing for 2 mismatches in the adapter sequence
Trimmed reads were aligned against the hg19 reference sequence allowing for 1 mismatch
Reads matching more than 10 locations in the genome were discarded
For all other reads, upto 5 best matches were considered
A read was assigned to a miRNA only if the 5' end of the read matched the 5' end of the miRNA
Genome_build: hg19, miRBase (version 18)  annotations were used to assign reads to miRNA genes
Supplementary_files_format_and_content: tab-delimited file containing the miRNA name and number of reads assigned to it by the Avadis NGS quantification method
 
Submission date Aug 12, 2013
Last update date May 15, 2019
Contact name Aishwarya Narayanan
Organization name Strand Life Sciences
Street address 5th Floor, KBP, Bellary Road
City Bangalore
ZIP/Postal code 560024
Country India
 
Platform ID GPL10999
Series (1)
GSE49816 Evaluation of quantitative miRNA gene expression platforms in the microRNA Quality Control (miRQC) study
Relations
BioSample SAMN02316032
SRA SRX334049

Supplementary file Size Download File type/resource
GSM1207659_s20.counts.tsv.gz 12.0 Kb (ftp)(http) TSV
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap