GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1229097

Query DataSets for GSM1229097

Status

Public on Oct 01, 2013

Title

cL5

Sample type

SRA

Source name

Big Male Zurich

Organism

Pan troglodytes

Characteristics

Sex: male
age: 35.02
rin: 7.9
tissue: liver

Extracted molecule

polyA RNA

Extraction protocol

Samples were obtained from brain (pre-frontal cortex), heart, kidney, liver, and testis tissues of male humans, chimpanzees and rhesus macaques. Samples were processed in tissue batches, randomizing species in library preparation and sequencing.
Illumina NlaIII DGE libraries for all samples were generated following the vendor protocol. Expressed 3' tags from polyA RNAs

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina Genome Analyzer

Data processing

Brain and liver samples were sequenced on seven different flow cells of an Illumina Genome Analyzer I. Sequencing data was analyzed starting from Illumina 'chastity' filtered FastQ files. For these files, quality scores were converted to PHRED-scale (Ewing and Green 1998). Heart, kidney and testis samples were sequenced on ten different flow cells on the Genome Analyzer II platform, and sequences called with Ibis (Kircher, Stenzel, and Kelso 2009).
PHRED-scaled FastQ files from both platforms were filtered for adapter and chimera sequences (Kircher, Heyn, and Kelso 2011) and reads with at least 9nt of the adapter sequence (TCGTATGCCGTCTTCTGCTTG) at the read end removed. The last read base (the first adapter base) of the remaining 18nt reads was clipped off, and reads with more than 1 base below a quality score of 10 were discarded. Further, reads with sequence entropy below 0.85 were removed, as these are likely to originate from flow cell artifacts (Kircher, Heyn, and Kelso 2011).
We extended the reads by a 'CATG' restriction motif and aligned these using bowtie 0.12.4 (Langmead et al. 2009) to the following versions of the human, chimpanzee and rhesus macaque genomes: hg19/GRCh37 (excluding additional haplotypes), pantro2/CGSC 2.1 and rhemac2/MGSC Merged 1.0 (with the addition of a mitochondrial genome sequence from the Ensembl MMUL_1.54 build). Bowtie was configured to report up to 100 equally good alignments (with up to two mismatches) and to discard reads that produce more than 100 alignments (parameters -a -m 100 --best --strata).
We used the non-symmetrical UCSC liftOver chains and the command line tool liftOver in a reciprocal manner, to transfer gene start and end coordinates of the human Ensembl v59 annotation separately, and required the projected coordinates to be on the same chromosome and strand. Further, the new gene length was not permitted to change length by more than a factor of 10, or at most 100kb. The rhesus genome does not include a mitochondrial genome in the assembly version provided by UCSC. Hence, all 37 mitochondrially encoded genes were projected using a ClustalW (Thompson, Higgins, and Gibson 1994) mitochondrial genome alignment of the three species. From a total of 51,715 genes, 43,020 (83%) could be projected to chimpanzee and 33,259 (64%) to chimpanzee and rhesus macaque.
For quantifying gene expression, bowtie outputs of mapped tags were sorted by coordinates. Per-site counts were determined and sites observed fewer than three times were removed, to reduce the effect of including erroneous alignments in long transcripts.
Genome_build: hg19/GRCh37, pantro2/CGSC 2.1 and rhemac2/MGSC Merged 1.0

Submission date

Sep 11, 2013

Last update date

May 15, 2019

Contact name

Jay Shendure

Organization name

University of Washington

Department

Genome Sciences

Lab

Shendure