GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1234731

Query DataSets for GSM1234731

Status

Public on Jul 21, 2017

Title

Sh_G7_T5_A

Sample type

SRA

Source name

First trifoliate

Organism

Glycine soja

Characteristics

treatment: Shift (LD 3 weeks -> SD 5 days)
timepoint: evening 10:30 pm
age at rna extraction: 26 DAP

Treatment protocol

For LD treatment, plants were exposed to 16 hours of light from 6:45 until 22:45. For SD treatment, plants were exposed to 10 hours of light from 6:45 until 16:45. For shift treatment, plants were grown under LD for 21 days and shifted to SD for 5 days. Sampling was carried out 26 DAP (days after planting) at three time points every 8 hours over a 24 hour period with 3 biological replicates.

Growth protocol

Plants were grown under long-day (16L:8D) or short-day (10L:14D) conditions for 26 days. For the shift experiment, plants were grown under long-day for three weeks were treated with short-day for 5 days. Sampling was carried out at three time points every 8 hours over a 24 hour period with 3 biological replicates.

Extracted molecule

total RNA

Extraction protocol

Plant samples were ground and RNAs were extracted using the RNeasy® Plant Mini Kit (Qiagen®).
The RNAseq libraries were prepared with Illumina's 'TruSeq RNAseq Sample Prep kit. The libraries were pooled and quantitated by qPCR, and sequenced for 101 cycles on a HiSeq2000 using a TruSeq SBS sequencing kit version 3 and analyzed with Casava-1.8 (pipeline 1.9), following the manufacturer's instructions (Illumina, San Diego, CA).

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2000

Description

Read_counts: 11951221

Data processing

The quality-scores line in fastq files processed with Casava1.8 using an ASCII offset of 33 (known as Sanger scores) instead of the previous 64 offset. (pools 1-2-3 run 160, HiSeq#1 with an error rate of 0.84 %, pools 4-5 run 162, HiSeq#1 with an error rate of 0.54% pools 6 through 12, run 226 HiSeq#2error rate: 0.88%).
Adapter Sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
Reads were aligned onto soybean transcriptome (williams 82) obtained from Phytozome database (Schmutz et al, 2010) using Bowtie aligner (Langmead et al, 2009) with following parameters; -S -q -k 1 --best -p 4 --phred33-quals
Supplementary_files_format_and_content: tab-delimited text file include RPKM values for each Sample.

Submission date

Sep 19, 2013

Last update date

May 15, 2019

Contact name

Yoshie Hanzawa

E-mail(s)

yhanzawa@illinois.edu

Phone

2173334685

Organization name

University of illinois at Urbana Chammpaign, USA