|
| Status |
Public on Feb 17, 2016 |
| Title |
HITS-CLIP_AD_3 |
| Sample type |
SRA |
| |
|
| Source name |
advanced Alzheimer's Disease_brain
|
| Organism |
Homo sapiens |
| Characteristics |
disease status: advanced Alzheimer's Disease
tissue: brain
tissue subtype: dorsolateral prefrontal cortex
|
| Growth protocol |
Frozen brain tissue from control and advanced AD subjects was obtained from the Mount Sinai Brain Bank.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Brain tissue was UV irradiated and subjected to nELAVL HITS-CLIP (detailed description in accompanying paper)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Description |
advanced Alzheimer's Disease subject
|
| Data processing |
library strategy: HITS-CLIP
filtering (min:0-4:20,mean:5-29:20)
collapsing of exact sequences
stripping of degenerate linker (5nt; ends with a G)
removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG)
alignment with novoalign (unambigous mapping)
collapsing of PCR duplicates
Genome_build: hg18
Supplementary_files_format_and_content: bed file containing genomic coordinates of unique unambigously mapped reads
|
| |
|
| Submission date |
Dec 29, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Claudia Scheckel |
| E-mail(s) |
claudia.scheckel@gmail.com
|
| Organization name |
University Hospital Zurich
|
| Department |
Institute of Neuropathology
|
| Street address |
Schmelzbergstrasse 12
|
| City |
Zurich |
| State/province |
NY |
| ZIP/Postal code |
8091 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL10999 |
| Series (2) |
| GSE53695 |
nELAVL HITS-CLIP in Alzheimer's Disease patients |
| GSE53699 |
nELAVL HITS-CLIP and RNA-seq in Alzheimer's Disease patients and IMR-32 neuroblastoma cells |
|
| Relations |
| BioSample |
SAMN02486977 |
| SRA |
SRX400204 |
