|
| Status |
Public on Apr 01, 2014 |
| Title |
tofu-4(tm6157) capped small RNA |
| Sample type |
SRA |
| |
|
| Source name |
tofu-4(tm6157) capped small RNA
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain background: N2
genotype/variation: tofu-4(tm6157) mutation in N2 background
age: 3 days post L1 release
growth medium type: Solid NGM plate
clipping sequence: TGGAATTCTCGGGTGCCAAGGC
molecule subtype: Capped small RNA
|
| Growth protocol |
Staged N2 or N2-based mutant L1s were grown on NGM plates for 3 days at 20oC. Staged VT1012 L1s were grown in S Basal buffer (with 100µg/ml ampicilin and 4mM IPTG) for 4 days at 20oC.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Staged 12-36hr adults were harvested and washed with M9 buffer until supernatant was clear. Worms were homogenized in trizol reagent, subjected to 3 cycles of freezing in liquid nitrogen and thawing at room temperature before RNA extraction by phase separation and isopropanol precipitation.
Small RNA libraries: 20µg of total RNA was size selected on a 15% denaturing polyacrylamide (dPAA) gel to obtain 19-30nt RNA species. The resultant RNA was ligated at its 3’end to the Illumina RA3 using NEB truncated T4 RNA ligase 2 at 20OC for 2 hours. Ligated products were size selected on a 15% dPAA before being ligated at its 5’end to RA5 using Ambion T4 RNA ligase at 20OC for 2 hours. Ligated products were size selected on a 15% dPAA before being reverse transcribed with RTP and superscript III reverse transcriptase. Resultant cDNAs were amplified using RP1 forward primer and indexed reverse primers using NEB Phusion PCR mastermix. Amplified libraries were gel purified on a 2% low-melting agarose gel and sequenced using the Illumina Hi-seq platform. Capped small RNA libraries: Protocol is the same as that of small RNA library generation with 2 differences. First, 19-30nt size-selected RNA was de-phosphorylated at the 5’end with NEB CIP at 37oC for 1 hour before 3’ ligation. Second, 3’ ligated RNA was treated with Epicenter TAP to convert all 5’ RNA caps into 5’ monophosphates before 5’ ligation. RA3: /5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/ (ddC: dideoxyC, rN: ribonucleotide, p: phosphate). RA5: rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC. RTP: GCCTTGGCACCCGAGAATTCCA. RP1: AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA. RPI: CAAGCAGAAGACGGCATACGAGATIIIIIIGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA (IIIIII: 6-mer Illumina index sequence).
Small RNA cloning and capped small RNA cloning
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Sample 30
|
| Data processing |
Basecalling with Illumina Real Time Analysis
Sequenced reads longer than 15nt were trimmed for adaptor sequences, clipped of any 3' adaptor sequences, and mapped to ce6 genome using bowtie 0.12.8 with parameters -v 0 -k 10 -m 10.
Mapped reads were annotated by virtue of overlap with (in decreaseing priority) 21U-RNA loci, miRNA loci, genic regions, repeat regions.
Small RNA reads were quantified as raw small RNA read count per million non-structural mapped RNA reads.
Genome_build: ce6
Supplementary_files_format_and_content: tab-delimited text of small RNA reads that map to 21U-RNA loci with read counts (normalized to total mapped unstructured RNA reads)
|
| |
|
| Submission date |
Jan 09, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Wee Siong Sho Goh |
| E-mail(s) |
shogoh@szbl.ac.cn
|
| Organization name |
Shenzhen Bay Laboratory
|
| Department |
Institute of Molecular Physiology
|
| Lab |
Sho Goh Laboratory
|
| Street address |
Shenzhen Bay Laboratory, No. 5, Kelian Road, Goh Lab, A1819, Guangming District
|
| City |
Shenzhen |
| State/province |
Guangdong |
| ZIP/Postal code |
518107 |
| Country |
China |
| |
|
| Platform ID |
GPL13657 |
| Series (1) |
| GSE53970 |
A Genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis |
|
| Relations |
| BioSample |
SAMN02580680 |
| SRA |
SRX424526 |
