|
Status |
Public on Feb 27, 2014 |
Title |
THP1-A-1 |
Sample type |
genomic |
|
|
Source name |
5C library from THP1 cell line
|
Organism |
Homo sapiens |
Characteristics |
cell line: THP1 mll state: AF9 leukemia type: AML
|
Growth protocol |
Grown in Roswell Park Memorial Institute medium (RPMI 1640; Invitrogen™) containing 10% FBS (HyClone), 50 mM 2-mercaptoethanol (Invitrogen™), 1mM sodium pyruvate (Invitrogen™), 10 mM HEPES (Invitrogen™), and 1% penicillin-streptomycin (Invitrogen™).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
5C libraries were generated by incubating an individual 3C library with a pool of 5C primers to a final volume of 10ul of annealing buffer (20mM tris-acetate pH 7.9, 50mM potassium acetate, 10mM magnesium acetate, and 1mM dithiothreitol), and to final individual primer concentrations of 20nM. 5C primers were annealed to 3C templates overnight at 48ºC, and ligated the following day by adding 20ul of ligation buffer containing 10 units of Taq DNA ligase (NEB; 25mM Tris-HCl pH 7.6, 31.25mM potassium acetate, 12.5mM magnesium acetate, 1.25mM NAD, 12.5mM dithiothreitol, 0.125% Triton X-100) for 1h at 48ºC. The reactions were terminated by a 10 minute incubation at 65ºC.
|
Label |
Cy5
|
Label protocol |
The 5C libraries were amplified by PCR with the T7 (TAATACGACTCAACTATAGCC) and 5'-Cy3-labelled T3 (TATTAACCCTCACTAAAGGGA) primers, respectively. Unincorporated primers and other contaminants were removed from the 5C libraries using the MinElute Reaction Cleanup kit (Qiagen®).
|
|
|
Hybridization protocol |
As per the manufacturer’s guidelines, approximately 100 ng of 5C library were individually hybridized to arrays using the NimbleGen CGH Hybridization kit.
|
Scan protocol |
5C arrays were scanned with a DNA microarray scanner (Agilent Technologies, model G2505) at 5 µm resolution.
|
Description |
Raw feature file from scanning 5C library on microarray and corresponding normalized data
|
Data processing |
Raw data were extracted from the images using the NimbleScan 2.6 software (NimbleGen Systems, Inc.), and specific features were extracted with our 'ArrayQC' software and then normalized using our 'Ifcalculator' software. 420 out of over 350,00 probes: 5C data filtered for noise and normalized for both quantity of DNA hybridized (using a gene desert) and primer pair efficiency (using a BAC library)
|
|
|
Submission date |
Feb 26, 2014 |
Last update date |
Feb 27, 2014 |
Contact name |
Josée Dostie |
E-mail(s) |
josee.dostie@mcgill.ca
|
Phone |
1-514-398-4975
|
Organization name |
McGill University
|
Department |
Biochemistry
|
Street address |
3655 Promenade Sir-William-Osler
|
City |
Montreal |
State/province |
QC |
ZIP/Postal code |
H3G 1Y6 |
Country |
Canada |
|
|
Platform ID |
GPL18341 |
Series (2) |
GSE55406 |
Classifying leukemia types with chromatin conformation data (5C) |
GSE55408 |
Classifying leukemia types with chromatin conformation data |
|