 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 23, 2015 |
| Title |
ChrRNA_siCstF64+siCstF64tau |
| Sample type |
SRA |
| |
|
| Source name |
HeLa cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HeLa
net-seq antibody: none
treatment: CstF64 siRNA + CstF64tau siRNA
|
| Treatment protocol |
SMARTpool siRNA against human CPSF73 (CPSF3) and CstF64 (CSTF2) were purchased from Thermo scientific. ON-TARGET plus siRNA against Xrn2 was made by Thermo Scientific as following sequences. Sense: AAGAGUACAGAUGAUCAUGUU, Antisense: 5'-P CAUGAUCAUCUGUACUCUUUU. Silencer select siRNA against CstF64 tau (CSTF2T) was designed by Life technologies as following sequence, Sense: CCAUUAUUGACUCACCCUAtt, Antisense: UAGGGUGAGUCAAUAAUGGgc. These siRNA (final conc. 30nM) were transfected into HeLa cell using Lipofectamine RNAiMAX reagent (Life technologies) according to the manual and incubated for 72 hours.
|
| Growth protocol |
HeLa cells were maintained in DMEM with 10% fetal bovine serum
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Chromatin RNA fraction was prepared from ~80% confluent HeLa cells in 100mm Dishes. Approximately 7x106 cells were washed with ice-cold PBS twice. The cells were lysed with ice-cold 4 ml of HLB/NP40 buffer (10 mM Tris-Hcl pH 7.5, 10 mM NaCl, 0.5% NP40 and 2.5 mM MgCl2) and incubated on ice for 5 min. After the incubation, 1 ml of ice-cold HLB/NP40/Sucrose buffer (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 0.5% NP40, 2.5 mM MgCl2 and 10 % Sucrose) was under-laid and then the nuclei were collected under 1,400 rpm centrifuge at 40C for 5 min. Isolated nuclei were resuspended in 1.25 ml of NUN1 solution (20 mM Tri-HCl pH 8.0, 75mM NaCl, 0.5 mM EDTA, 50% Glycerol and proteinase inhibitor 1xComplete (Roche)) and added 1.2 ml NUN2 buffer (20 mM HEPES-KOH pH 7.6, 7.5 mM MgCl2, 0.2 mM EDTA, 300 mM NaCl, 1 M Urea, 1% NP40, proteinase inhibitor 1xComplete and phosphatase inhibitor 1xPhosStop (Roche)). 15 min incubation was carried out on ice with mixing by max speed vortex for 5 sec every ~4 min and then chromatin pellets were precipitated under 13,000 rpm centrifuge at 4oC for 10min. Chromatin pellet was resuspended in 200 ml HSB (10mM Tris-HCl pH 7.5, 500 mM NaCl and 10 mM MgCl2) with 0.25 U/ml TURBO DNase (Life technologies) at 37oC for 10 min and then treated with Proteinase K for 10 min. RNA was extracted by Trizol reagent (Life technologies). This extraction steps were repeated three times.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
chromatin-bound RNA
|
| Data processing |
For mNET-seq data, adaptor trimming was preformed using Cutadapt (v1.1), only keeping the reads with more than 10 bases.
mNET-seq data was then aligned to the human genome (build hg19) using TopHat (v2.0.9), with a minimum anchor length of 5 bases and allowing only for unique alignments.
For ChrRNA-seq and NucleoplasmRNA-seq data, alignment was preformed using TopHat (v2.0.9) with a minimum anchor length of 5 bases, allowing only for unique alignments and allowing read pairs to be separated by up to 3kb.
To aquire the last nucleotide incorporated by the polymerase in the aligned mNET-seq reads, a combination of SAMtools and inhouse python scripts was used
Then, ChrRNA-seq, NucleoplasmRNA-seq and mNET-seq singe-nucleotide aligned reads were separated by strand using SAMtools, selecting the strands according to the read flag.
To make bedgraphs of the reads aligning in different strands, genomeCoverageBed (v2.17.0) was used.
After that, the values in the bedgraphs were normalized to reads per 108 sequences using an inhouse python script.
Finally, to convert the bedgraphs to bigWig, the program bedGraphToBigWig from UCSC was used.
Genome_build: hg19
Supplementary_files_format_and_content: processed data files are in bigWig format; the scores in the files represent the number of reads per 108 sequences
|
| |
|
| Submission date |
Aug 12, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Tomás Gomes |
| E-mail(s) |
tomasgomes@medicina.ulisboa.pt
|
| Organization name |
Instituto de Medicina Molecular
|
| Street address |
Av. Professor Egas Moniz
|
| City |
Lisboa |
| ZIP/Postal code |
1649-028 Lisboa |
| Country |
Portugal |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE60358 |
Mammalian NET-seq reveals genome-wide nascent transcription coupled to RNA processing |
|
| Relations |
| BioSample |
SAMN02983280 |
| SRA |
SRX675986 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1474237_ChrRNA_siCstF64si64tau_F.bw |
163.2 Mb |
(ftp)(http) |
BW |
| GSM1474237_ChrRNA_siCstF64si64tau_R.bw |
154.9 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
