 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 23, 2015 |
| Title |
NET-seq HeLa S3 DMSO |
| Sample type |
SRA |
| |
|
| Source name |
HeLa S3 cells DMSO
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HeLa S3
library type: 3'end RNA fragment sequencing
treatment: DMSO
|
| Growth protocol |
HeLa S3 cells (ATCC, CCL-2.2) were grown in DMEM containing 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin until 90% confluent.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cell fractionation was performed as described in (Pandya-Jones & Black, RNA, 2009), (Bhatt et al., Cell, 2012) and based on (Wuarin & Schibler, MCB, 1994) with modifications. All subsequent steps have been conducted on ice or at 4°C and in the presence of 25 µM α-amanitin (Sigma, A2263), 50 Units SUPERaseIN (Life Technologies, AM2696) and Protease inhibitors cOmplete (Roche, 11873580001) according to manufacturer’s instructions using RNAse free equipment. All buffers have been pre-chilled on ice before use. The cell pellet corresponding to 1x107 cells was gently resuspended in 200 µl cytoplasmic lysis buffer (0.15% NP-40, 10 mM Tris-HCl pH 7.0, 150 mM NaCl). The cell lysate was incubated for 5 min on ice, layered onto 500 µl sucrose buffer (10 mM Tris-HCl pH 7.0, 150 mM NaCl, 25% sucrose) and centrifuged at 16,000 g for 10 min. The supernatant corresponding to the cytoplasmic fraction was carefully removed. For subcellular RNA-seq (described below) the cytoplasmic fraction was mixed with 3.5x volumes of RLT buffer (74104, QIAGEN). RNA purification from the cytoplasmic and following fractions is described below.
Sequencing library preparation was performed as described in (Churchman & Weissman, 2012) with modifications. 3 µg of purified chromatin associated RNA was used to prepare one DNA sequencing library. 3’ ligation of RNA with a DNA linker was performed essentially as originally described, except that a DNA linker with a mixed random hexameric sequence at its 5’ end was used (new DNA linker: 5’-AppNNNNNNCTGTAGGCACCATCAAT/3ddC-3’). The ligation efficiency was monitored by ligating the new DNA linker to a 28 nt long RNA control oligo (oGAB11: 5’-AGUCACUUAGCGAUGUACACUGACUGUG-3’OH). The ligation efficiency as determined by polyacrylamide gel electrophoresis was ≥95%. After ligation the RNA was fragmented by partial alkaline hydrolysis essentially as originally described. The fragmentation time was adjusted so that most RNA molecules were fragmented into the range of 35 to 100 nt, size-selected and converted into cDNA. Reverse transcription was performed with the following modifications to the original protocol. First, for reverse transcription a new RT primer was used (oLSC007: 5’-Phos/ATCTCGTATGCCGTCTTCTGCTTG/iSp18/CACTCA/iSP18/ TCCGACGATCATTGATGGTGCCTACAG-3’). Second, the RT primer was applied at a lower final concentration (1.9 µM instead of 10.9 µM). Next, cDNA was circularized and vectors that contained cDNA corresponding to original mature snRNAs, snoRNAs, rRNAs and mitochondrial tRNAs that were heavily sequenced in first NET-seq experiments were specifically depleted. For specific depletion, biotinylated oligos were designed that were complementary to the 3’ ends of the 19 most heavily sequenced mature RNAs of HeLa S3 cells (see Supplemental Table S1). Depletion was performed similar to the rRNA depletion approach described by (Ingolia et al., Nature Protocols, 2012). Per depletion 5.0 µl circularization reaction was used. 5.0 µl of circularization reaction was combined with 1.0 µl depletion oligo pool (10 µM of each oligo, prepared in 10 mM Tris-HCl, pH 8.0; see Supplemental Table S1), 1.0 µl 20x SSC (Life Technologies, AM9763) and 3.0 µl DNase-free H2O. Tubes were placed in a thermal cycler, denatured for 90 sec at 99°C and then annealed at 0.1°C s-1 to 37°C. Tubes were incubated for 15 min at 37°C. 37.5 µl of MyOne Streptavidin C1 DynaBeads (10 mg/ml, Life Technologies, 65001) were used per depletion reaction. Magnetic beads were washed 3x with 1x bind/wash buffer (1M NaCl, 0.5 mM EDTA, 2.5 mM Tris-HCl pH 7.0, 0.1% (vol/vol) Triton-X-100). After the last wash, magnetic beads were resuspended in 15 µl 2x bind/wash buffer (2 M NaCl, 1 mM EDTA, 5 mM Tris-HCl pH 7.0, 0.2% (vol/vol) Triton-X-100) and incubated at 37°C. 10 µl of the depletion reaction were transferred directly to the bead aliquot, immediately mixed by pipetting and incubated for 15 min at 37°C with mixing at 1000 rpm. Finally, tubes were transferred to a magnetic rack and 20 µl of supernatant were recovered and isopropanol precipitated. After depletion, the circularized DNA served as template for PCR amplification. PCR amplification was performed as originally described (Churchman & Weissman, 2012), using minimal amplification cycles. The concentration, the quality and the size distribution of final DNA libraries were assessed by Qubit 2.0 Fluorometer (Invitrogen) and 2100 Bioanalyzer (Agilent) measurements. 3’ end sequencing was performed on NextSeq 500 (SE 75 nt) and HiSeq 2000 (SE 50 nt) Illumina sequencing platforms using the following custom sequencing primer: oLSC006: 5’-TCCGACGATCATTGATGGTGCCTACAG-3’.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
nascent RNA
library strategy: NET-seq
|
| Data processing |
For NET-seq and HEK 293T cytoplasmic RNA-seq libraries, the six 5’ end nucleotides corresponding to the molecular barcode, are trimmed from the reads, but remain associated with the read using a custom python script.
For all samples, reads are aligned using the STAR aligner (v2.4.0) (Dobin et al., 2013) with the following parameters : --clip3pAdapterSeq ATCTCGTATGCCGTCTTCTGCTTG --clip3pAdapterMMp 0.21 --clip3pAfterAdapterNbases 1 –outFilterMultimapNmax 101 –outSJfilterOverhangMin 3 1 1 1 –outSJfilterDistToOtherSJmin 0 0 0 0 –alignIntronMin 11 –alignEndsType EndToEnd. The reference genome used consisted in the human reference genome (hg19), with additional sequences containing the rDNA sequences (genBank U13369.1, genBank U67616.1), and the sequence of processed tRNA (with the additional CCA at their end, and intron removed, when present).
For NET-seq data, to avoid any bias towards favoring annotated regions the alignment was performed without providing transcriptome information, while for RNA-seq data, the GENCODE annotation v16 was used as the transcriptome.
Only uniquely aligned reads are kept to generate the processed data files.
For NET-seq data, only the position corresponding to the 5’ end of the sequencing read (after removal of the barcode), which corresponds to the 3’ end of the nascent RNA fragment, is recorded with a custom python script using HTSeq package (Anders et al., 2014), while the whole read coverage is recorded for RNA-seq data.
For NET-seq and HEK 293T cytoplasmic RNA-seq libraries, reverse transcription mispriming events are identified where barcode sequences correspond exactly to the genomic sequence adjacent to the aligned read. These reads are removed from further analysis.
For NET-seq and HEK 293T cytoplasmic RNA-seq libraries, the few reads that align to the same genomic position and contain identical barcode are considered PCR duplication events and are filtered out.
For NET-seq libraries, evidence of splicing intermediates (Figure S1F) revealed that at sites where intermediates map (exact single bp 3’ ends of introns and exons) it is unclear which reads are due to splicing intermediate contamination and which are due to 3’ ends of nascent RNA. Thus, reads that map precisely at the exact single bp ends of introns and exons are discarded and the single 1 bp genomic positions are removed from subsequent analysis.
Genome_build: hg19
Supplementary_files_format_and_content: BedGraph files (http://genome.ucsc.edu/goldenPath/help/bedgraph.html); Column1=chromosome; Column2=start (left most coordinate; 0 based; position included); Column3=end (right most coordinate; 0 based; position not included); Column4=Coverage (3'end nt for NET-seq and whole read for RNA-seq).
|
| |
|
| Submission date |
Sep 16, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Stirling Churchman |
| E-mail(s) |
churchman@genetics.med.harvard.edu
|
| Organization name |
Harvard Medical School
|
| Department |
Genetics
|
| Street address |
77 Avenue Louis Pasteur
|
| City |
Boston |
| State/province |
Massachusetts |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE61332 |
Native Elongating Transcript Sequencing Reveals Human Transcriptional Activity at Nucleotide Resolution |
|
| Relations |
| BioSample |
SAMN03069603 |
| SRA |
SRX701641 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1505442_HeLaS3_DMSO.neg.bedgraph.gz |
100.5 Mb |
(ftp)(http) |
BEDGRAPH |
| GSM1505442_HeLaS3_DMSO.pos.bedgraph.gz |
105.8 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
