|
| Status |
Public on Nov 24, 2014 |
| Title |
control ES |
| Sample type |
SRA |
| |
|
| Source name |
Embryonic Stem Cells
|
| Organism |
Mus musculus |
| Characteristics |
cell type: Embryonic Stem Cells
cell line: E14 - EGFP vector only
condition: 12 days of reprogramming in TS conditions
|
| Treatment protocol |
During the experimental time course of trans-differentiation, cells were plated on MEFs in TS cell conditions as specified with the appropriate inducer (Dox or 4HT) at a seeding density of approximately 1x10E4 cells/25cm2. Media was changed every 2 days. Cells were trypsinized after 6 days of culture and re-plated, again at 1x10E4 cells/25cm2 in TS conditions, for another 6 days.
|
| Growth protocol |
Prior to the start of the reprogramming protocol, ES and TS cells were cultured in routine conditions on a layer of irradiated mouse embryonicfibroblasts (MEFs). ES cells were maintained in serum+LIF conditions, and TS cells in 70% MEF-conditioned media, 30% TS media, with 25ng/ml bFGF and 1µg/ml Heparin.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
At the end of the trans-differentiation time-course, cells were FACS-purified to remove MEFs, and DNA extracted with phenol-chloroform according to standard protocols. DNA was used for MeDIP analysis as described previously (Senner et al., Stem Cells 2012).
Genomic DNA was fragmented by sonication (Diagenode Bioruptor), and adaptor ligated with paired-end adaptors 5’-PGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3’ and 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3’ (* Phosphorothioate group) and the NEBnext library preparation kit. Subsequently immunoprecipitaions with an anti-5-methylcytosine antibody were carried out in triplicate. IP triplicates –prepared for each cell type – were pooled and MeDIP DNA libraries were column-purified (MinElute, Qiagen) and eluted in 17μl of EB buffer (pre-warmed at 55ºC). DNA unbound fractions were processed in parallel. MeDIP libraries (and unbound DNA fractions, as control) were amplified by PCR for 12 cycles using distinct combinations of primers: PE 1.0 (Fw) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT; PE 2.0 (Rv) CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT; iPCR tag6 (Rv) CAAGCAGAAGACGGCATACGAGATACATTGGCGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC; iPCR tag7 (Rv) CAAGCAGAAGACGGCATACGAGATCAGATCTGGAGA TCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC; iPCR tag8 (Rv) CAAGCAGAAGACGGCATACGAGATCATCAAGTGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC. Amplified MeDIP libraries (and unbound DNA fractions, as control) were resolved by 2% agarose gel electrophoresis, and DNA fragments within the 300-500 nt range were cut out and DNA was purified using the Qiagen Gel extraction kit. 5mC immuno-precipitation efficiency was confirmed by analysing ES and TS cell MeDIP pre- and post-amplification libraries by quantitative PCR for candidate loci (Elf5, Nanog). Library concentration was determined using KAPA Illumina SYBR Universal Lid Q Kit (ANACHEM) and by Bioanalyzer.
|
| |
|
| Library strategy |
MeDIP-Seq |
| Library source |
genomic |
| Library selection |
5-methylcytidine antibody |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Data processing |
Genomic mapping of paired-end reads was performed with Bowtie (v0.12.8) using the following parameters: -m 1 --strata --best -X 700. Reads were mapped to the mouse genome build NCBIM37. Final data analysis was performed using SeqMonk software (www.bioinformatics.babraham.ac.uk).
Genome_build: NCBIM37
genome-wide quantification file: Quantitated MeDIP-Seq files were generated for 1kb non-overlapping genomic tiles using SeqMonk (v0.28.0). The result file carries descriptive column headers and is tab-delimited; the relevant columns are: (1) ID; (2) Chromosome; (3) Start; (4) End; (13-21) Raw read count per 1kb tile
|
| |
|
| Submission date |
Oct 07, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Felix Krueger |
| E-mail(s) |
fkrueger@altoslabs.com
|
| Organization name |
Altos Labs
|
| Department |
Bioinformatics
|
| Street address |
Granta Park
|
| City |
Cambridge |
| ZIP/Postal code |
CB21 6GP |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL11002 |
| Series (2) |
| GSE62138 |
Epigenetic memory of the first cell fate decision prevents complete ES cell reprogramming into trophoblast [MeDIP-Seq] |
| GSE62150 |
Epigenetic memory of the first cell fate decision prevents complete ES cell reprogramming into trophoblast |
|
| Relations |
| BioSample |
SAMN03098091 |
| SRA |
SRX726869 |
