GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1544763

Query DataSets for GSM1544763

Status

Public on Mar 20, 2015

Title

MS04T74

Sample type

SRA

Source name

hIPSC, feeder free

Organism

Homo sapiens

Characteristics

cell line: 585A1
cell type: hIPSC, feeder free

Growth protocol

The mouse embryonic stem cell (mESC) line BVSC R8 was cultured in a 2i+LIF, feeder-free culture condition.
For the analysis of human iPSCs (hiPSCs), the two iPSC lines, 585A1 and 585B1, were cultured either under a conventional culture condition [DMEM/F12 [Life Technologies (11330-32), Carlsbad, CA] supplemented with 20% (vol/vol) Knockout Serum Replacement [KSR; Life Technologies (10828-028)], 1% (vol/vol) GlutaMax [Life Technologies (35050-061)], 0.1 mM nonessential amino acids [Life Technologies (11140-050)], 4 ng/ml recombinant human bFGF [Wako Pure Chemical Industries (064-04541), Osaka, Japan] and 0.1 mM 2-mercaptoethanol [Sigma-Aldrich (M3148)]] on the SNL feeder cells [Watanabe, K., et al. (2007). Nature Biotechnology, 25(6), 681.] or under a feeder-free condition as reported previously [Nakagawa, M., et al. (2014). Scientific Reports, 4, 3594.][Miyazaki, T., et al. (2012). Nature Communications, 3, 1236.].

Extracted molecule

total RNA

Extraction protocol

Total RNAs from the mouse embryonic stem cell (mESC) line BVSC R8 were extracted using an RNeasy mini kit [Qiagen (74104), Hilden, Germany] according to the manufacturer’s instructions. The isolated RNAs were serially diluted by double-distilled water (DDW) to concentrations of 250 ng/μl, 25 ng/μl, 2.5 ng/μl, 250 pg/μl, and 25 pg/μl for use in evaluation of the quantitative performance of the SC3-seq.
For isolating mouse blastocysts, C57BL/6 mice were mated and noon of the day when a copulation plug was identified was designated as embryonic day (E) 0.5. At E4.5, peri-implantation blastocysts were flushed from the uteri by KSOM [Merck Millipore (MR-020P-5D), Darmstadt, Germany], and then they were bisected into a polar part containing an inner cell mass (ICM) and polar trophectoderm (pTE) and a mural part containing mural TE (mTE) by a glass needle under a dissection microscope [Leica Microsystems (M80), Wetzlar, Germany]. Each fragment was incubated with 0.25% trypsin/PBS [Sigma-Aldrich (T4799), St. Louis, MO] for around 10 min at 37°C, then dissociated into single cells by repeated pipetting, and dispersed in 0.1 mg/ml of PVA/PBS [Sigma-Aldrich (P8136)] in preparation for the SC3-seq analysis.
For the isolation of single hiPSCs cultured with the feeders, the culture was first treated with CTK solutions [0.25% Trypsin [Life Technologies (15090-046)], 0.1 mg/mL Collagenase IV [Life Technologies (17104-019)], 1 mM CaCl2 [Nacalai Tesque (06729-55)] (Fujioka, T., et al. (2004). Int.J.Dev.Biol., 48(10), 1149.)] for the removal of the feeder cells, then dissociated into single cells using Accutase [Innovative Cell Technologies, San Diego, CA]. For the preparation of single cells from a feeder-free system, the cells were dissociated into single cells with 0.5 × TrypLE Select [TrypLE Select [Life Technologies (12563011)] diluted 1:1 with 0.5 mM EDTA/PBS] [Nakagawa, M., et al. (2014). Scientific Reports, 4, 3594.]. Dissociated single hiPSCs were transferred several times into a pick-up medium consisting of 1% KSR/PBS containing 10 μM of the ROCK inhibitor Y-27632 [Wako Pure Chemical Industries (257-00511)] [Watanabe, K., et al. (2007). Nature Biotechnology, 25(6), 681–686.] in preparation for the SC3-seq analysis.
cDNA synthesis and amplification from isolated RNAs/single cells were perfomed essentially as reported in [Kurimoto, K.et.al., Nucleic Acids Research, 34(5), e42.] except that the spike-in RNAs developed by the External RNA Control consortium [ERCC; Life Technologies (4456740)] were used and different numbers of PCR cycles were employed for amplification depending on the amounts of starting total RNAs (total RNA 100 ng: 7 cycles; 10 ng: 11 cycles; 1 ng: 14 cycles; 100 pg: 17 cycles; 10 pg: 20 cycles). 5 ng of amplified and quality-checked cDNAs were added to the pre-amplification buffer [1 × ExTaq buffer [Takara Bio (RR006), Shiga, Japan], 0.2 μM of each dNTP [Takara Bio (RR006)], 0.01 μg/μl of the N-V3 (dT)24 primer (HPLC-purified, attachment of amine at the 5-prime end), 0.01 μg/μl of the V1(dT)24 primer (HPLC-purified), and 0.025 U/μl of ExTaqHS [Takara Bio (RR006)]], and were amplified by four cycles of PCR. The surplus primers and PCR byproducts such as primer dimers were removed by size selection through three rounds of purification using a 0.6 × volume of AMPureXP beads for each round [Beckman Coulter (A63881), Tokyo, Japan] according to the manufacturer’s instructions. The purified cDNAs were diluted to 130 μl by double-distilled water (DDW) and fragmented by shearing with Covaris S2 or E210 (duty cycle: 10%; intensity: 5; cycles per burst: 200; duration: 50 seconds; an intensifier was installed in the case of E210) [Covaris, Woburn, MA], and then end-polished in the End-polish buffer [1 × NEBnext End Repair Reaction buffer [NEB (B6052S), Ipswich, MA], 0.01 U/μl of T4 DNA polymerase [NEB (M0203)], and 0.033 U/μl of T4 polynucleotide kinase [NEB (M0201)]] for 30 min at 20oC. After incubation, a 0.8 × volume of the AMPureXP was immediately added, the solution was mixed for more than 20 min, and then the supernatant was transferred to a 1.2 × volume of the AMPureXP reagent and the cDNAs were purified. Next, to provide the purified cDNAs with an Int-adaptor sequence, the cDNAs were incubated in 30 μl of the Internal adaptor extension buffer [1 × ExTaq Buffer, 0.23 mM of each dNTP, 0.67 μM of the IntV1 (dT)24 primer (HPLC-purified), 0.033 U/μl of ExTaqHS] using the following thermal cycler program: 95oC for 3 min, 67oC for 2 min, and 72oC for 2 min. The reactions were terminated by chilling in an ice-block, and after the addition of 20 μl of the P1-adaptor ligation buffer [a mixture of 10 μl of 5 × NEBNext Quick Ligation Reaction Buffer [NEB (B6058S)], 0.6 μl of 5 μM of the P1-T adaptor [Life Technologies (4464411)], and 1 μl of T4 ligase [NEB (M0202M)]], the solution was incubated for 15 min at 20oC and for 20 min at 72oC. After two rounds of cDNA purification by adding a 1.2 × volume of AMPure XP, the cDNAs were added into the Final amplification buffer [1 × ExTaq buffer, 0.2 mM of each dNTP, 1 μM of the P1 primer, 1 μM of the BarT0XX_IntV1 primer (HPLC-purified), 0.025 U/μl of ExTaqHS] and amplified by PCR using the following thermal cycler program: 95oC for 3 min; followed by 9 cycles of 95oC for 30 sec, 67oC for 1 min and 72oC for 1 min; with a final extension of 72oC for 3 min. Finally, the cDNA libraries were purified two times by using a 1.2 × volume of AMPureXP and dissolved in 20 μl of TE buffer. The quality and quantity of the constructed libraries were evaluated by LabChip GX or Bioanalyzer 2100, a Qubit dsDNA HS assay kit [Life Technologies (Q32851)], and a SOLiD Library TaqMan Quantitation kit [Life Technologies (4449639)]. The cDNA libraries were sequenced with an ABI SOLiD 5500XL system (Applied Biosystems) for 50-bp single-end reads according to the instructions of the manufacturer.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

AB 5500xl Genetic Analyzer

Description

SC3seq amplified from single cell of hIPSC, feeder free

Data processing

All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-c -m 30 -a CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -g CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the mouse genome mm10 and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—no-length-correction” and “—library-type fr-secondstrand” options and mm10 reference gene annotations with extended TTSs. We also set the cufflinks option “—max-mle-iterations” to 50,000, because default iterations (5,000) resulted in “FAILED” when estimating the expression levels of some genes. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Genome_build: mm10
Supplementary_files_format_and_content: Tab-delimited text files with abundance measurements

Submission date

Nov 13, 2014

Last update date

May 15, 2019

Contact name

Yukihiro Yabuta

E-mail(s)

yabyab@anat2.med.kyoto-u.ac.jp

Organization name

Kyoto University, Graduate school of medicine

Department

Anatomy and Cell Biology