NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1570245 Query DataSets for GSM1570245
Status Public on May 27, 2015
Title RNA-seq_control_2
Sample type SRA
 
Source name Replicate#2:total RNA from water-treated rosette leaves
Organism Arabidopsis thaliana
Characteristics cultivar: Columbia-0
tissue: rosette leaves
Treatment protocol 4-week-old plants (before bolting) wre treated with 5 μM coronatine (COR) or water (control) for 1 hr
Growth protocol Arabidopsis thaliana Col-0 seeds were imbibed in water at 40C in darkness for 4 days for stratification, grown on soil (Arabidopsis mix) under long-day conditions (16 h of light/8 h of dark) at a fluence rate of 100 μmol/m2/s1 and watered with ½ strength Hoagland nutrient solution once per week (otherwise with deionized water).
Extracted molecule total RNA
Extraction protocol To assess the effect of environmental stimuli on nucleosome occupancy, plants were treated with coronatine (COR) (Sigma, St. Louis, MO) or water (control) for 1 hr. The harvested samples were ground with liquid nitrogen and divided into 3 aliquots for nucleosome genomic DNA (gDNA), naked gDNA, and RNA isolation. For isolating nucleosome gDNA, the nuclei were purified from one aliquot with nuclei extraction buffer (10 mM Hepes (pH 7.6), 5mM potassium chloride, 5 mM magnesium chloride, 1 M sucrose, 14 mM β-mercaptoethanol, 0.6% Triton-X 100, 0.4 mM phenylmethanesulfonyl fluoride, 1x ethylenediaminetetraacetic acid-free protease inhibitor (Roche, Mannheim, Germany)), digested with 0.4 U/μl micrococcal nuclease (MNase) (NEB, MA, USA) for 9 min, and purified with phenol/chloroform. To generate the naked gDNA sample, the gDNA was isolated without the nucleus isolation step as described previously (Dellaporta et al. 1983), purified with phenol/chloroform to strip off proteins, and digested with 0.25 U/μl MNase (NEB, MA, USA) for 1.75 or 3 min. Total RNA was purified with the E.Z.N.A. Plant RNA kit (Omega Bio-Tek, GA, USA)
The purified nucleosome and naked gDNA was used to construct a library for 50-bp paired-end sequencing following the Illumina protocol. The purified total RNA was used to construct a library for 50-bp single-end sequencing following the Illumina protocol.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2500
 
Description Adaptor sequence: 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG
Data processing Adaptor sequences were trimmed from the sequence reads. Adaptor sequences is for TrueSeq-3.
The RNA-seq reads to the genome through TopHat with the options (-I 500 -g 1; otherwise with default). Transcript levels of annotated genes were determined and shown as FPKM (Fragments Per Kilobase per Million fragments mapped) calculated with Cufflinks
genome_build: Reference genome dataset was retrieved from The Arabidopsis Information Resources (TAIR10; http://www.arabidopsis.org).
processed_data_files_format_and_content: The "Processed data_RNA-expression" contains the RNA expression (FPKM value) of annotated genes in 4 RNA samples (RNA-seq_control#1, RNA-seq_control#2, RNA-seq_COR#1, RNA-seq_COR#1).
 
Submission date Dec 19, 2014
Last update date May 15, 2019
Contact name Ming-Jung Liu
E-mail(s) mjliu@gate.sinica.edu.tw
Organization name Academia sinica
Street address 128 Sec. 2, Academia Rd, Nankang
City Taipei
ZIP/Postal code 11529
Country Taiwan
 
Platform ID GPL17639
Series (1)
GSE64397 Determinants of nucleosome positioning and their influence on plant gene expression
Relations
BioSample SAMN03271514
SRA SRX819516

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap
External link. Please review our privacy policy.