|
Status |
Public on May 27, 2016 |
Title |
RNA-Seq analysis of placenta (basal plate and villi) tissue from CTL04 (A23160) |
Sample type |
SRA |
|
|
Source name |
A23160-1
|
Organism |
Homo sapiens |
Characteristics |
submitted sample id: JOC236-RNA donor_id: CTL04 Sex: male body site: Placenta histological type: Basal plate tissue is tumor: No biomaterial_type: primary tissue tissue_type: placenta (basal plate and villi) tissue
|
Extracted molecule |
total RNA |
Extraction protocol |
library construction protocol: Refer to document 'Strand Specific 96-well Library Construction for Illumina Sequencing' from BC at the Roadmap Epigenomics Project site, Experimental Protocols page (URL: http://www.roadmapepigenomics.org/protocols/type/experimental/)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
design description: RNA-Seq analysis of placenta (basal plate and villi) tissue from CTL04 (A23160) using Illumina HiSeq 2000 library name: A23160 EXPERIMENT_TYPE: mRNA-Seq EXTRACTION_PROTOCOL: Total RNA was extracted using Trizol from Invitrogen as per manufacturer's instructions. LIBRARY_GENERATION_PCR_POLYMERASE_TYPE: Phusion LIBRARY_GENERATION_PCR_THERMOCYCLING_PROGRAM: 98C 30 sec, 10 cycle of 98C 10 sec, 65C 30 sec, 72C 30 sec, then 72C 5 min, 4C hold LIBRARY_GENERATION_PCR_NUMBER_CYCLES: 13 LIBRARY_GENERATION_PCR_F_PRIMER_SEQUENCE: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT LIBRARY_GENERATION_PCR_R_PRIMER_SEQUENCE: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT LIBRARY_GENERATION_PCR_PRIMER_CONC: 0.5 uM LIBRARY_GENERATION_PCR_PRODUCT_ISOLATION_PROTOCOL: 8% Novex TBE PAGE gel purification RNA_PREPARATION_REVERSE_TRANSCRIPTION_PRIMER_SEQUENCE: NNNNNN RNA_PREPARATION_REVERSE_TRANSCRIPTION_PROTOCOL: Invitrogen Superscript II RT LIBRARY_GENERATION_PCR_TEMPLATE: cDNA EXTRACTION_PROTOCOL_MRNA_ENRICHMENT: Purification of polyA+ mRNA using MultiMACS 96 Separation Unit RNA_PREPARATION_INITIAL_RNA_QLTY: RIN 7.6 RNA_PREPARATION_INITIAL_RNA_QNTY: 2.34 ug LIBRARY_FRAGMENTATION: COVARIS E210 LIBRARY_FRAGMENT_SIZE_RANGE: 240-420 bp **************** For data usage terms and conditions, please refer to: http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies ****************
|
Data processing |
Various levels of processed data files will be made available as this project proceeds.
|
|
|
Submission date |
Jan 12, 2015 |
Last update date |
May 15, 2019 |
Contact name |
UCSF-UBC CENTER |
Organization name |
UCSF-UBC
|
Street address |
UCSF-UBC
|
City |
San Francisco |
State/province |
CA |
ZIP/Postal code |
94143 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE16368 |
UCSF-UBC Human Reference Epigenome Mapping Project |
|
Relations |
SRA |
SRX1158092 |
BioSample |
SAMN03416704 |