|
Status |
Public on Feb 15, 2008 |
Title |
Conventional_rep3 |
Sample type |
RNA |
|
|
Source name |
10pg RNA, conventional experiment, replicate 3
|
Organism |
Mus musculus |
Characteristics |
Strain: B6.C3Sn, Gender: Female, Age : Adult, Tissue : forebrain
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted from a wild-type forebrain and treated with DNAse using Nucleospin RNA L kit (Macherey-Nagel) according to the manusfacturer’s instructions.
|
Label |
Cy5
|
Label protocol |
10pg of RNA were reverse-transcribed with 1µM of each following primer : Smart A (AAGCAGTGGTATCAACGCAGAGTACGCGGG) and 3’CDS (AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN) and 140U Rtases Reverse-iT Blend (ABgene) in tube for 20 minutes at 37°C. cDNAs were then amplified in the presence of 1.25µM 5’PCR primer (AAGCAGTGGTATCAACGCAGAGT) and 1X Advantage® 2 polymerase (Clontech) by TS-PCR : 95°C for 2 minutes then 40 cycles 95°C for 15s, 65°C for 30s and 68°C for 6 minutes, in a conventional PCR machine (9700, Applera).
|
|
|
Hybridization protocol |
RNG-MRC_MM25k_EVRY microarrays (Le brigand et al., NAR, 2006) were first incubated in a humid chamber for 2 hours to rehydrate the spots then placed for 1 hour in a dessicator and blocked for 1 hour at room temperature in 50mM Sodium Borate pH 9, 0.003% ethanolamine. Slides were then washed 5 minutes with water and dried by centrifugation. Hybridizations were performed in 50% formamide, 5X Denhardt’s, 4x SSC and 0.1% SDS solution at 42°C for 16 hours. Microarrays were then washed at room temperature 5 minutes in 2X SSC, 0.1% SDS, 5 minutes in 1X SSC, 5 minutes in 0.2X SSC and 5 minutes in 0.05X SSC. Slides were finally dried by centrifugation 4 minutes at 900rpm.
|
Scan protocol |
Microarray images were obtained using a ScanArray Gx scanner (Perkin Elmer) with laser power = 90% and PMT gain = 80%. Median signal and median local background intensities were extracted from the images using Mapix v2.2.4 software (Innopsys).
|
Description |
Third replicate of conventional experiment performed with 10pg total RNA in a 10µL in tube.
|
Data processing |
Intensity/background ratios were calculated for each spot in each experiment.
Features which were not interpretable in all the 9 experiments performed were excluded for further analysis. For comparing experiments, the sum of F/B values for each slide was then multiplied by a correcting factor so that the sum of the corrected ratios was equal in all experiments.
|
|
|
Submission date |
Feb 02, 2007 |
Last update date |
Feb 08, 2008 |
Contact name |
Luce Dauphinot |
E-mail(s) |
luce.dauphinot@upmc.fr
|
Phone |
33 1 57274518
|
Organization name |
INSERM U1127-CNRS UMR7225-UPMC
|
Department |
ICM
|
Lab |
Alzheimer and Prions Disease team
|
Street address |
47 boulevard de l'hôpital
|
City |
Paris |
ZIP/Postal code |
75013 |
Country |
France |
|
|
Platform ID |
GPL4736 |
Series (1) |
GSE6941 |
Integrating whole transcriptome assays on a lab-on-a-chip for single cell gene profiling |
|