|
Status |
Public on Jul 13, 2015 |
Title |
HEMn-LP_miRNA |
Sample type |
SRA |
|
|
Source name |
melanocyte_cell_line_HEMn-LP
|
Organism |
Homo sapiens |
Characteristics |
cell line: HEMn-LP
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was extracted from HEMn-LP, A375, and A2058 cell lines using TRIzol® Reagent (Invitrogen, Carlsbad, CA) per manufacturer’s instruction cDNA library was constructed using Small RNA Sample Preparation Kit (Illumina)
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer II |
|
|
Data processing |
Sequenced reads were firsly transformed to fasta file Fasta files wer aligned to the UCSC reference human genome using miRDeep2 software by default setting (3' adaptor is TCGTATGCCGTCTTCTGCTTGT) Genome_build: hg19 Supplementary_files_format_and_content: tab-delimited text files include read count values and normalized values for each Sample
|
|
|
Submission date |
Mar 12, 2015 |
Last update date |
May 15, 2019 |
Contact name |
yadong yang |
E-mail(s) |
yangyd@big.ac.cn
|
Organization name |
Beijing Institute of Genomics
|
Street address |
No.1-104 Beichen West Road, Chaoyang
|
City |
Beijing |
ZIP/Postal code |
100101 |
Country |
China |
|
|
Platform ID |
GPL9115 |
Series (1) |
GSE66823 |
Deep sequencing analysis of microRNA expression in human melanocyte and melanoma cell lines |
|
Relations |
BioSample |
SAMN03401910 |
SRA |
SRX954779 |