|
| Status |
Public on Jul 13, 2015 |
| Title |
A375_miRNA |
| Sample type |
SRA |
| |
|
| Source name |
low_metastatic_cell_line_A375
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: A375
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from HEMn-LP, A375, and A2058 cell lines using TRIzol® Reagent (Invitrogen, Carlsbad, CA) per manufacturer’s instruction
cDNA library was constructed using Small RNA Sample Preparation Kit (Illumina)
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Data processing |
Sequenced reads were firsly transformed to fasta file
Fasta files wer aligned to the UCSC reference human genome using miRDeep2 software by default setting (3' adaptor is TCGTATGCCGTCTTCTGCTTGT)
Genome_build: hg19
Supplementary_files_format_and_content: tab-delimited text files include read count values and normalized values for each Sample
|
| |
|
| Submission date |
Mar 12, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
yadong yang |
| E-mail(s) |
yangyd@big.ac.cn
|
| Organization name |
Beijing Institute of Genomics
|
| Street address |
No.1-104 Beichen West Road, Chaoyang
|
| City |
Beijing |
| ZIP/Postal code |
100101 |
| Country |
China |
| |
|
| Platform ID |
GPL9115 |
| Series (1) |
| GSE66823 |
Deep sequencing analysis of microRNA expression in human melanocyte and melanoma cell lines |
|
| Relations |
| BioSample |
SAMN03401908 |
| SRA |
SRX954780 |
