GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1643175

Query DataSets for GSM1643175

Status

Public on Jul 20, 2015

Title

d4_wt1

Sample type

SRA

Source name

d4 AG+ cells

Organism

Homo sapiens

Characteristics

cell line: 1-7
cell type: d4 AG+ cells

Growth protocol

hiPSCs were maintained under a feeder-free condition [StemFitTM (Ajinomoto, Tokyo, Japan) medium on recombinant LAMININ511 (rLN511E8) (iMatrix-511, Nippi, Tokyo, Japan)-coated cell culture plates] (Nakagawa et al., 2014). The iMeLCs were induced by plating 1.0-2.0 × 10^5 hiPSCs maintained in StemFitTM onto a well of a human plasma fibronectin (Millipore, FC010)-coated 12-well plate in GK15 medium [GMEM (Life Technologies) with 15% KSR, 0.1 mM NEAA, 2 mM L-glutamine, 1 mM sodium pyruvate and 0.1 mM 2-mercaptoethanol] containing 50 ng/ml of Activin A, 3 µM of CHIR99021 and 10 µM of a ROCK inhibitor (Y-27632; Wako Pure Chemical Industries). The hPGCLCs were induced by plating 3.0 × 10^3 iMeLCs or iPSCs into a well of a low-cell-binding V-bottom 96-well plate (Thermo, 81100574) in GK15 supplemented with 1000 U/ml of LIF (Millipore, #LIF1005), 200 ng/ml of BMP4, 100 ng/ml of SCF (R&D Systems, 455-MC), 50 ng/ml of EGF (R&D Systems, 236-EG), and 10 µM of the ROCK inhibitor. In some experiments, PD173074 (StemGent, #04-0008) or LDN193189 (StemGent, #04-0074) were added for iMeLCs or hPGCLC induction, respectively. In other experiments, WNT3A (R&D Systems, 5036-WN) was used in place of CHIR99021, and BMP2 (R&D Systems, 355-BM), BMP7 (R&D Systems, 354-BP), or BMP8A (R&D Systems, 1073-BP) was used in place of BMP4.
mESCs were cultured in a 2i+LIF, feeder-free culture condition. mEpiLCs and mPGCLCs (d2, d4, and d6) were induced as described previously (Hayashi et al., 2011).
cyESCs (CMK9) were cultured with conventional hESC medium [DMEM/F12 (Life Technologies) supplemented with 20% (vol/vol) of KSR (Life Technologies), 1 mM of sodium pyruvate (Life Technologies), 2 mM of GlutaMax (Life Technologies), 0.1 mM of nonessential amino acids (Life Technologies), 0.1 mM of 2-mercaptoethanol (Sigma-Aldrich), 1000 U/mL of ESGRO mouse LIF (Millipore), 4 ng/ml of recombinant human bFGF (Wako Pure Chemical Industries)] on mouse embryonic feeders (MEFs).

Extracted molecule

total RNA

Extraction protocol

Total RNA was extracted from hiPSCs, iMeLCs, and hPGCLCs or mESCs, mEpiLCs, and mPGCLCs by using an RNeasy Micro Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Synthesis and amplification of cDNAs using 1 ng of purified total RNA, and construction of cDNA libraries for RNA sequencing (ABI SOLiD 5500XL system; Life Technologies) were performed as described in (Nakamura et al., 2015).
For isolating single cells of cyESCs for the SC3-seq analysis [Nakamura et.al., Nuceic Acids Res. (2015)], cells were first detached as clumps by the CTK solution [0.25% of Trypsin (Life Technologies), 0.1 mg/mL of Collagenase Ⅳ (Life Technologies), 1 mM of CaCl2 (Nacalai Tesque)], were incubated in 0.25% of trypsin/PBS (Sigma-Aldrich) for around 10 min at 37℃, and were then dispersed into single cells in 1% (vol/vol) KSR/PBS. Genital ridges were dissected out and were dissociated into single cells by incubating with 0.25% trypsin/PBS for around 10 min at 37℃ followed by repeated pipetting. The resulting single cells were dispersed in 0.1 mg/ml of PVA/PBS (Sigma-Aldrich) and were processed for the SC3-seq analysis (Nakamura et al., 2015).
cDNA synthesis and amplification from isolated RNAs/single cells were perfomed essentially as reported in [Kurimoto, K.et.al., Nucleic Acids Research, 34(5), e42.]. Library constructions for SOLiD System were performed as reported in [Nakamura et.al., Nuceic Acids Res. (2015)].

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

AB 5500xl Genetic Analyzer

Description

SC3seq amiplified from 1 ng total RNA extracted from cells sorted with AG
processed data file: expression_human.txt

Data processing

All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-c -m 30 -a CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -g CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the genome and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—no-length-correction” and “—library-type fr-secondstrand” options and reference gene annotations with extended TTSs. We also set the cufflinks option “—max-mle-iterations” to 50,000, because default iterations (5,000) resulted in “FAILED” when estimating the expression levels of some genes. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Genome_build: mm10
Genome_build: hg19
Genome_build: Macaca_fascicularis_5.0
Supplementary_files_format_and_content: tab-delimited text files include RPM values for each Sample.

Submission date

Mar 25, 2015

Last update date

May 15, 2019

Contact name

Yukihiro Yabuta

E-mail(s)

yabyab@anat2.med.kyoto-u.ac.jp

Organization name

Kyoto University, Graduate school of medicine

Department

Anatomy and Cell Biology