 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 30, 2023 |
| Title |
T2DM_Adductor_2 |
| Sample type |
SRA |
| |
|
| Source name |
Adductor muscle of type 2 diabetic mice collected at day-7 post FAL
|
| Organism |
Mus musculus |
| Characteristics |
strain background: C57BL/6
mouse status: type 2 diabetic
time point: at day-7 post FAL
tissue: Adductor muscle
|
| Treatment protocol |
Unilateral hindlimb ischemia was induced by ligating the femoral artery distal to the origin of the profunda femoral artery. Thus arteriogenesis will predominate in the adductor muscles and angiogenesis predominates in the gastrocnemius and tibilais muscles.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Tissues were snap frozen in liquid nitrogen and Total RNA was isolated from both normoxic adductor and ischemic gastrocnemius muscles using RNeasy Fibrous Tissue Mini Kit (QIAGEN Finland, Helsinki, Finland) according to manufacturer's instructions.
Total RNA was enriched for Poly (A)+ RNA with MicroPoly (A) Purist Kit (Ambion, Austin, TX, USA). RNA was treated with TURBO DNase (Ambion), fragmented using RNA Fragmentation Reagents (Ambion) and purified by running through P-30 column (Bio-Rad, Hercules, CA, USA). Fragmented RNA was dephosphorylated with Antarctic phosphatase (New England Biolabs, Ipswich, MA, USA) followed by heat-inactivation. Dephosphorylation reactions were mixed with 2 x Novex TBE-Urea sample buffer (Invitrogen), briefly denatured and loaded on a Novex denaturing 15% polyacrylamide TBE-urea gel according to the manufacturer’s instructions. Fragments of 50-300 nucleotides in length were gel purified . Also the poly (A)+ tailing and cDNA synthesis was performed the next day. However, for reverse transcription oligos with custom barcodes (underlined) were used: 5’phosCA/TG/AC/GTGATCGTCGGACTGTAGAACTCT/idSp/CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3’. After cDNA synthesis, exonuclease was used to catalyze the removal of excess oligos. Enzyme was inactivated and RNA hydrolyzed by alkaline treatment (100 mM NaOH) and heat (25 min, 95°C). The cDNA fragments of ~150-200 bps were purified on a denaturing Novex 10% polyacrylamide TBE-urea gel (Invitrogen). The recovered cDNA was circularized, linearized, amplified for 8 cycles. The final product was ran on Novex 10%TBE gel, gel purified as above and cleaned-up using ChIP DNA clean & Concentrator Kit (Zymo Research Corporation, Irvine, CA, USA). The library was sequenced for 50 cycles on the Illumina HiSeq 2000 according to the manufacturer’s instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Libraries were sequenced for 50 cycles on an Illumina HiSeq 2000 according to the manufacturer’s instructions.
RNA-Seq results were trimmed to remove 3' A-stretches originating from the library preparation and poor quality reads were filtered out (minimum 97% of bp over quality cutoff 10).
Reads were aligned to the mm9 genome using Tophat.
Data analysis was performed using HOMER and the detailed instructions for analysis can be found at http://homer.salk.edu/homer/
Genome_build: mm9
Supplementary_files_format_and_content: Gene expression values (RPKM) and UCSC Bedgraphs are provided
|
| |
|
| Submission date |
May 21, 2015 |
| Last update date |
Jan 30, 2023 |
| Contact name |
Minna U Kaikkonen |
| E-mail(s) |
minna.kaikkonen@uef.fi
|
| Organization name |
University of Eastern Finland
|
| Department |
A.I. Virtanen Institute, Department of Biotechnology and Molecular Medicine
|
| Street address |
P.O. Box 1627
|
| City |
Kuopio |
| ZIP/Postal code |
70211 |
| Country |
Finland |
| |
|
| Platform ID |
GPL13112 |
| Series (1) |
| GSE69123 |
Genome-wide transcriptional alterations during vascular growth in skeletal muscles of type 2 diabetic mice in response to femoral artery ligation |
|
| Relations |
| BioSample |
SAMN03703980 |
| SRA |
SRX1036335 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1693147_T2DM_Adductor_2.ucsc.bedGraph.gz |
47.6 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
