NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1821651 Query DataSets for GSM1821651
Status Public on Mar 24, 2016
Title rep1_PacBio_HZ18-SplitMS2
Sample type SRA
 
Source name cells in exponential growth (Galactose)
Organism Saccharomyces cerevisiae
Characteristics strain: BY4741
genotype: MATa ade2 ade3 his3 leu2-3,112 trp1 URA3::Pgal1:pHZ18Split-MS2
sample identifier: TGAAAGGATCTCGAGACTAG
Treatment protocol For nascent RNA extraction, 1l of cells was pelleted, washed with ice-cold PBS, quick-frozen in liquid nitrogen in 6 aliquots and kept at -80°C.
Growth protocol Cell cultures were grown in complete media (YPD) at 30°C and 250 rpm. For cell growth with Galactose as carbon source, cells were grown in YP containing 1% Raffinose and 2% D-Galactose. Cells were harvested in exponential growth at an OD (595nm) of 0.5-1.
Extracted molecule total RNA
Extraction protocol Nascent RNA was prepared using a nascent RNA isolation protocol for yeast (Carrillo Oesterreich et al. 2010) and Phenol:Chloroform:IAA, 25:24:1, pH 6.6 extraction.
Nascent RNA was 3’ end ligated to the DNA adaptor (/5rApp/NNNNNCTGTAGGCACCATCAAT/3ddC/) and reverse transcribed into cDNA with a slight modification of the SMARTer PCR cDNA Synthesis Kit (Clontech).
A custom primer reverse-complement to the 3’ end adaptor was used (AAGCAGTGGTATCAACGCAGAGTACATTGATGGTGCCTACAG). Maximal 1 µg of RNA was used per reaction.
The subsequent low cycle PCR was carried out with the Advantage 2 PCR Kit according to the instructions provided by the kit.
Double-stranded cDNA was further used for Pacific Biosciences library preparation and sequencing with standard protocols and kit from Pacific Biosciences (SMRTbell™ Template Prep Kit 1.0).
SMRT DNA sequencing (Pacific Biosciences)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model PacBio RS II
 
Description Nascent RNA
Data processing PacBio SMRT Analysis v2.3.0 software was used to obtain CCS reads (reads of inserts protocol).
Fastq files were filtered and trimmed for the 3’ end DNA adaptor and downstream Clontech adaptor sequences with cutadapt 1.8 (-a CTGTAGGCACCATCAAT -n 1 -O 17 -e 0.1 –match-read-wildcards –discard-untrimmed -m 15).
Also the reverse-complement adaptor was trimmed (-g ATTGATGGTGCCTACAG) and the read was reverse-complemented.
Demultiplexing (MS2_reads_of_insert.fastq) was also done similarly using the sample identifier and its reverse-complement identifier.
Trimmed fastq-files were catenated and the remaining 5 nt random 3’ barcode was removed using the FASTX toolkit (fastx_trimmer -Q 33 -t 5, version 0.0.13).
Reads with 5’ and 3’ end adaptors were trimmed and retained for mapping (cutadapt -g AAGCAGTGGTATCAACGCAGAGTACATGGG -n 3 -O 30 -e 0.1 –match-read-wildcards –discard-untrimmed -m 10).
Processed fastq-data were mapped to the genome version S. cerevisiae sacCer3 or S. pombe EF2 using gmap 2013-05-09 (-d <genome_index> –min-intronlength=30 –intronlength=1010 (850 S. pombe) –localsplicedist=1010 (850 S. pombe) –totallength=1010 ( 850 S. pombe) –trimendexons=0 –microexon-spliceprob=0.5 –direction=auto –find-shifted-canonical –allow-close-indels=2 –npaths=1 –nofails –fails-as-input –mapboth -A –format=samse).
genome build: sacCer3 and S. pombe EF2
processed data files format and content: mapped data in sam- or bed-format
 
Submission date Jul 14, 2015
Last update date May 15, 2019
Contact name Lydia Herzel
E-mail(s) lydia.herzel@fu-berlin.de
Organization name Freie Universität
Department Biology, Chemistry and Pharmacy
Lab Herzel
Street address Takustr. 6
City Berlin
ZIP/Postal code 14195
Country Germany
 
Platform ID GPL20200
Series (2)
GSE70906 Long read sequencing of nascent RNA from S. cerevisiae and S. pombe
GSE70908 Splicing of nascent RNA coincides with intron exit from RNA polymerase II
Relations
BioSample SAMN03858437
SRA SRX1097162

Supplementary file Size Download File type/resource
GSM1821651_468_1.sorted.sam.gz 166.5 Kb (ftp)(http) SAM
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap