|
| Status |
Public on Mar 24, 2016 |
| Title |
rep2_PacBio_HZ18-SplitMS2 |
| Sample type |
SRA |
| |
|
| Source name |
cells in exponential growth (Galactose)
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
strain: BY4741
genotype: MATa ade2 ade3 his3 leu2-3,112 trp1 URA3::Pgal1:pHZ18Split-MS2
sample identifier: GTTGCGGATCTCGAGACTAG
|
| Treatment protocol |
For nascent RNA extraction, 1l of cells was pelleted, washed with ice-cold PBS, quick-frozen in liquid nitrogen in 6 aliquots and kept at -80°C.
|
| Growth protocol |
Cell cultures were grown in complete media (YPD) at 30°C and 250 rpm. For cell growth with Galactose as carbon source, cells were grown in YP containing 1% Raffinose and 2% D-Galactose. Cells were harvested in exponential growth at an OD (595nm) of 0.5-1.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nascent RNA was prepared using a nascent RNA isolation protocol for yeast (Carrillo Oesterreich et al. 2010) and Phenol:Chloroform:IAA, 25:24:1, pH 6.6 extraction.
Nascent RNA was 3’ end ligated to the DNA adaptor (/5rApp/NNNNNCTGTAGGCACCATCAAT/3ddC/) and reverse transcribed into cDNA with a slight modification of the SMARTer PCR cDNA Synthesis Kit (Clontech).
A custom primer reverse-complement to the 3’ end adaptor was used (AAGCAGTGGTATCAACGCAGAGTACATTGATGGTGCCTACAG). Maximal 1 µg of RNA was used per reaction.
The subsequent low cycle PCR was carried out with the Advantage 2 PCR Kit according to the instructions provided by the kit.
Double-stranded cDNA was further used for Pacific Biosciences library preparation and sequencing with standard protocols and kit from Pacific Biosciences (SMRTbell™ Template Prep Kit 1.0).
SMRT DNA sequencing (Pacific Biosciences)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
PacBio RS II |
| |
|
| Description |
Nascent RNA
|
| Data processing |
PacBio SMRT Analysis v2.3.0 software was used to obtain CCS reads (reads of inserts protocol).
Fastq files were filtered and trimmed for the 3’ end DNA adaptor and downstream Clontech adaptor sequences with cutadapt 1.8 (-a CTGTAGGCACCATCAAT -n 1 -O 17 -e 0.1 –match-read-wildcards –discard-untrimmed -m 15).
Also the reverse-complement adaptor was trimmed (-g ATTGATGGTGCCTACAG) and the read was reverse-complemented.
Demultiplexing (MS2_reads_of_insert.fastq) was also done similarly using the sample identifier and its reverse-complement identifier.
Trimmed fastq-files were catenated and the remaining 5 nt random 3’ barcode was removed using the FASTX toolkit (fastx_trimmer -Q 33 -t 5, version 0.0.13).
Reads with 5’ and 3’ end adaptors were trimmed and retained for mapping (cutadapt -g AAGCAGTGGTATCAACGCAGAGTACATGGG -n 3 -O 30 -e 0.1 –match-read-wildcards –discard-untrimmed -m 10).
Processed fastq-data were mapped to the genome version S. cerevisiae sacCer3 or S. pombe EF2 using gmap 2013-05-09 (-d <genome_index> –min-intronlength=30 –intronlength=1010 (850 S. pombe) –localsplicedist=1010 (850 S. pombe) –totallength=1010 ( 850 S. pombe) –trimendexons=0 –microexon-spliceprob=0.5 –direction=auto –find-shifted-canonical –allow-close-indels=2 –npaths=1 –nofails –fails-as-input –mapboth -A –format=samse).
genome build: sacCer3 and S. pombe EF2
processed data files format and content: mapped data in sam- or bed-format
|
| |
|
| Submission date |
Jul 14, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Lydia Herzel |
| E-mail(s) |
lydia.herzel@fu-berlin.de
|
| Organization name |
Freie Universität
|
| Department |
Biology, Chemistry and Pharmacy
|
| Lab |
Herzel
|
| Street address |
Takustr. 6
|
| City |
Berlin |
| ZIP/Postal code |
14195 |
| Country |
Germany |
| |
|
| Platform ID |
GPL20200 |
| Series (2) |
| GSE70906 |
Long read sequencing of nascent RNA from S. cerevisiae and S. pombe |
| GSE70908 |
Splicing of nascent RNA coincides with intron exit from RNA polymerase II |
|
| Relations |
| BioSample |
SAMN03858438 |
| SRA |
SRX1097163 |
