|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Oct 29, 2015 |
Title |
NPC_chr4_119634899 |
Sample type |
SRA |
|
|
Source name |
NPC
|
Organism |
Mus musculus |
Characteristics |
cell type: NPC barcode: TTCTGGCTCAGGAGAGCATG bait: NPC_chr4_119634899
|
Treatment protocol |
cells are cross linked using 2% formaldehyde for 10minutes at room temperature in 10%FCS/PBS
|
Growth protocol |
E14Tg2A (E14) ES cells (IB10 cells) were cultured in BRL-conditioned Dulbecco’s Modified Eagle Medium (DMEM with High Glucose, GlutaMAX™, Pyruvate; Life technologies) supplemented with 10% fetal calf serum (FCS), non-essential amino acids (NEAA) (Life technologies), 1000 U/ml leukemia inhibitory factor (LIF) and 2-mercaptoethanol. NPCs were derived from E14 ESCs as described in Peric-Hupkes et al. (2010) and were cultured on gelatin (0.1%) coated plates in DMEM/F12 medium (GIBCO-BRL) with addition of N2-supplement (life technologies), human basic FGF (20ng/ml; peprotech), murine EGF (20ng/ml; peprotech) and penicillin-streptomycin (P/S) (50U/ml - 50ug/ml) (Life technologies). Fetal livers (FL) were isolated from e14.5 embryos by dissection. Single cell suspensions for FL were obtained by filtration through a cell strainer (BD biosciences).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
The initial steps of the 4C procedure, as published before (Simonis et al., 2006, Nature Genetics), remain unchanged. Cells are cross linked using 2% formaldehyde for 10min at room temperature in PBS 10%FCS, nuclei are isolated, after which chromatin is digested with DpnII or NlaIII and subsequently ligated. After reversal of the cross links the DNA is purified and treated with the second restriction enzyme treatment (Csp6I or NlaIII, respectively). After a second re-ligation step the sample is purified and a 4C PCR is performed.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
4C PCR product
|
Data processing |
The initial step in the 4C-seq analysis is the alignment of the sequencing reads to a reduced genome of sequences that flank DpnII or NlaIII sites (fragment ends) depending on the first restriction enzyme used, using custom perl scripts. Due to their ambiguous nature in reporting contacts, repetitive fragment ends were excluded from subsequent analysis. The reduced genome was based on mouse mm9. Genome_build: mm9 Supplementary_files_format_and_content: Wig files were generated from the 4C mapping procedure using custom perl scripts. Scores represent the number of reads mapping to a DpnII restriction fragment end.
|
|
|
Submission date |
Aug 31, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Elzo de Wit |
Phone |
+31 30 2121 800
|
Organization name |
Hubrecht Institute
|
Street address |
Uppsalalaan 8
|
City |
Utrecht |
ZIP/Postal code |
3584 CT |
Country |
Netherlands |
|
|
Platform ID |
GPL13112 |
Series (2) |
GSE72539 |
CTCF binding polarity determines chromatin looping [4C] |
GSE72720 |
CTCF binding polarity determines chromatin looping |
|
Relations |
BioSample |
SAMN04019094 |
SRA |
SRX1175456 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1864583_NPC_chr4_119634899.wig.gz |
1.2 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|