 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 10, 2015 |
| Title |
ZUMA-0022 |
| Sample type |
SRA |
| |
|
| Source name |
Blood
|
| Organism |
Pan troglodytes |
| Characteristics |
tissue: Blood
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
The method is based in the AUMA technique (Rodríguez, 2008; doi: 10.1093/nar/gkm1105), although important modifications were introduced to expand significantly the genomic coverage and to introduce internal controls that allow normalization and control of some technical biases. Briefly, one microgram of DNA was digested for 16 h at 25C with the methylation-sensitive restriction endonuclease SmaI (Roche Diagnostics GmH, Mannheim, Germany) leaving blunt ends (CCC/GGG), followed by a second digestion with the methylation-insensitive restriction enzyme MseI (T/TAA) (16h at 37C, Roche Diagnostics GmH, Mannheim, Germany) that leaves sticky ends. Adapters blunt-SmaI (ADPT-S1 GATAGTATGCCCGGGTGA plus the 5’ phosphorylated ADPT-S2 TCACCCGGGCATAC) and sticky-MseI (ADPT-M1 CTGAGGCTGGATCCCTG plus the 5’ phosphorylated ADPT-M2 TACAGGGATCCAGCCTCAG) were prepared by incubating the two oligonucleotides for 2 min at 65ºC and then cooling to room temperature for 30-60 min. Digested DNA and 2nmol of blunt and sticky adapters were ligated overnight at 16C using T4 DNA ligase (New England Biolabs, Beverly, MA). The product was purified using the Illustra GFX Purification kit (GE Healthcare, Buckinghamshire, UK) and eluted in 200 ul of bidistilled water. The ligation product consists of three types of molecules according to the flanking sites SmaI-SmaI, SmaI-MseI and MseI-MseI. Only the products containing SmaI adapters represent unmethylated fragments (Figure 1A). Next, a PCR (95ºC 2 min; 95ºC 30 sec, 60ºC 1 min, 72ºC 1min for 30 cycles; 72ºC 5min) was performed using two primers, one that anneals the MseI adapter (ADPT-M1A CTGAGGCTGGATCCCTGTAA) and another one homologous to the SmaI adapter plus TT at the 3’ end (ADPT-S1TT GATAGTATGCCCGGGTGAGGGTT) to enrich in Alu sequences. The final product appeared as a smear when run in an agarose gel and most of the amplicons ranged from 50 bp to 1000 bp.
The NSUMA PCR product was sheared by sonication with a Bioruptor (Diagenode) to a size of 100-300 bp. DNA fragments were blunt end repaired with T4 DNA polymerase and Klenow fragment (NEB) and purified with a QIAquick PCR purification kit (Qiagen). Thereafter, 3’-adenylation was performed by incubation with dATP and the Klenow (3´→5´ exo-) fragment of DNA polymerase I (NEB). DNA was purified using MinElute spin columns (Qiagen) and ligated to double-stranded adapters (GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG/ACACTCTTTCCCTACACGACGCTCTTCCGATCT) using rapid T4 DNA ligase (NEB). The sample was purified again using a MinElute spin column and run on a 2% agarose gel, and fragments in the size range of interest, 150 bp plus 65 bp of adapters, were excised with a sterile single-use scalpel and recovered from the gel by QIAquick gel extraction. Then, adapter-ligated fragments were enriched, and adapters were extended, by selectively amplifying with an 18-cycle PCR reaction using Phusion DNA polymerase (Finnzymes), and primers 1.1 (5’ P- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) and 2.0 (5’ P-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT) (library size of approximately 150 plus 92 bp of adapters). Finally, the quality of libraries was confirmed on the Agilent Technologies 2100 Bioanalyzer and by cloning into a blunt TOPO vector. Six colonies were sequenced by conventional Sanger method to verify correct adapter ligation and sequence match. Libraries were quantified by TaqMan Universal PCR No AmpErase kit (Applied Biosystems-Roche). DNA was loaded into a single read (SR) flow cell for cluster generation using a SR-cluster generation kit v4 (Illumina). During this process, DNA molecules were immobilized on the surface of the flow cell, amplified in situ to create same-sequence containing clusters, and following surface blocking and DNA denaturation, binding of sequencing primer was performed. The flow cell was then mounted on a Genome Analyzer II instrument for sequencing, and 35-50 sequencing cycles were carried out using v4 SBS kits. Each flow cell ran on the Genome Analyzer IIx contained a PhiX control lane (loaded at a concentration of 4pM) that was used to monitor run quality.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
NSUMA technique to assess the methylation status of Alu repeats
|
| Data processing |
Pre-processing. Reads sequences were obtained from the Illumina instruments qseq format and were pre-processed in different steps in order to remove misleading reads and improve the mapping accuracy. Bases at the 3’ end of the reads with low quality (PHRED score <= 2) were end clipped. The adapters sequence used in the PCR amplification were also removed using iterative searches of 5’ to 3’ fragments. Ambiguous bases (Ns) at both ends of the read were also removed. Finally, reads shorter than 10 bp or with more than 30% of ambiguous bases were filtered out from the analysis.
Mapping. Once trimmed and cleaned, reads were mapped to the human reference genome (build GRCh37/hg19) with Bowtie 0.12.7 using the following parameters: -S –p 8 –v 2 –phred64-quals –best –l 28 –k 2. The value of option v is the number of mismatches allowed.
Post-processing. Once mapped, ambiguous reads (those that are mapped in several genome locations) were disambiguated when the number of mismatches allowed the assignment of a unique position in the human genome with a higher probability, otherwise they were rejected. Reads mapped in unknown chromosome were annotated as chrUn (scaffolds and contigs which could not be placed on chromosomes) and excluded from further analyses. The unambiguous reads (including uniquely mapped reads) were selected for further analysis. The information was stored using the standard SAM/BAM format.
Counting of reads in regions of interest (NSUMA universe) was performed using coverageBed of the bedtools suite 2.16.2
Genome_build: hg19
Supplementary_files_format_and_content: Normalized number of reads by NSUMA amplicon for each sample.
Supplementary_files_format_and_content: ZUMA-xxxx_coverage.txt The file contains describes the amplicon location and its coverage according to the NSUMA technique in the sample. Consists in a BED6+ file depicting the (chromosome, start, end, amplicon_type, amplicon_numeric_identifier and strand) of the amplicon; plus four coverage columns, namely (number of reads in the amplion, number of bases of the amplicon covered with at lesat one read, the length of the amplicon, the fraction of bases of the amplicon that had non-zero coverage).
|
| |
|
| Submission date |
Sep 09, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Miguel A. Peinado |
| E-mail(s) |
mpeinado@igtp.cat
|
| Organization name |
IGTP
|
| Street address |
Can Ruti Campus
|
| City |
Badalona |
| ZIP/Postal code |
08916 |
| Country |
Spain |
| |
|
| Platform ID |
GPL9378 |
| Series (1) |
| GSE72877 |
The methylome of Alu repeats in primates |
|
| Relations |
| BioSample |
SAMN04044455 |
| SRA |
SRX1215004 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1874013_ZUMA-0022_coverage.txt.gz |
2.7 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
